ID: 997804793

View in Genome Browser
Species Human (GRCh38)
Location 5:136906318-136906340
Sequence ACCATATATACTGTTCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997804793_997804796 15 Left 997804793 5:136906318-136906340 CCAGTAAGAACAGTATATATGGT No data
Right 997804796 5:136906356-136906378 CATAGGAGAATTAATCAGGAAGG No data
997804793_997804794 -2 Left 997804793 5:136906318-136906340 CCAGTAAGAACAGTATATATGGT No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data
997804793_997804797 30 Left 997804793 5:136906318-136906340 CCAGTAAGAACAGTATATATGGT No data
Right 997804797 5:136906371-136906393 CAGGAAGGTATAGAATTTAGAGG No data
997804793_997804795 11 Left 997804793 5:136906318-136906340 CCAGTAAGAACAGTATATATGGT No data
Right 997804795 5:136906352-136906374 CAGACATAGGAGAATTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997804793 Original CRISPR ACCATATATACTGTTCTTAC TGG (reversed) Intergenic