ID: 997804794

View in Genome Browser
Species Human (GRCh38)
Location 5:136906339-136906361
Sequence GTCTTATAGAAATCAGACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997804788_997804794 16 Left 997804788 5:136906300-136906322 CCTTGTCACCAATGTTCCCCAGT No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data
997804786_997804794 22 Left 997804786 5:136906294-136906316 CCAGACCCTTGTCACCAATGTTC No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data
997804787_997804794 17 Left 997804787 5:136906299-136906321 CCCTTGTCACCAATGTTCCCCAG No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data
997804791_997804794 -1 Left 997804791 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data
997804790_997804794 0 Left 997804790 5:136906316-136906338 CCCCAGTAAGAACAGTATATATG No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data
997804789_997804794 8 Left 997804789 5:136906308-136906330 CCAATGTTCCCCAGTAAGAACAG No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data
997804785_997804794 26 Left 997804785 5:136906290-136906312 CCTTCCAGACCCTTGTCACCAAT No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data
997804784_997804794 27 Left 997804784 5:136906289-136906311 CCCTTCCAGACCCTTGTCACCAA No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data
997804793_997804794 -2 Left 997804793 5:136906318-136906340 CCAGTAAGAACAGTATATATGGT No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997804794 Original CRISPR GTCTTATAGAAATCAGACAT AGG Intergenic
No off target data available for this crispr