ID: 997804795

View in Genome Browser
Species Human (GRCh38)
Location 5:136906352-136906374
Sequence CAGACATAGGAGAATTAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997804790_997804795 13 Left 997804790 5:136906316-136906338 CCCCAGTAAGAACAGTATATATG No data
Right 997804795 5:136906352-136906374 CAGACATAGGAGAATTAATCAGG No data
997804789_997804795 21 Left 997804789 5:136906308-136906330 CCAATGTTCCCCAGTAAGAACAG No data
Right 997804795 5:136906352-136906374 CAGACATAGGAGAATTAATCAGG No data
997804788_997804795 29 Left 997804788 5:136906300-136906322 CCTTGTCACCAATGTTCCCCAGT No data
Right 997804795 5:136906352-136906374 CAGACATAGGAGAATTAATCAGG No data
997804787_997804795 30 Left 997804787 5:136906299-136906321 CCCTTGTCACCAATGTTCCCCAG No data
Right 997804795 5:136906352-136906374 CAGACATAGGAGAATTAATCAGG No data
997804793_997804795 11 Left 997804793 5:136906318-136906340 CCAGTAAGAACAGTATATATGGT No data
Right 997804795 5:136906352-136906374 CAGACATAGGAGAATTAATCAGG No data
997804791_997804795 12 Left 997804791 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data
Right 997804795 5:136906352-136906374 CAGACATAGGAGAATTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997804795 Original CRISPR CAGACATAGGAGAATTAATC AGG Intergenic
No off target data available for this crispr