ID: 997804796

View in Genome Browser
Species Human (GRCh38)
Location 5:136906356-136906378
Sequence CATAGGAGAATTAATCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997804789_997804796 25 Left 997804789 5:136906308-136906330 CCAATGTTCCCCAGTAAGAACAG No data
Right 997804796 5:136906356-136906378 CATAGGAGAATTAATCAGGAAGG No data
997804793_997804796 15 Left 997804793 5:136906318-136906340 CCAGTAAGAACAGTATATATGGT No data
Right 997804796 5:136906356-136906378 CATAGGAGAATTAATCAGGAAGG No data
997804790_997804796 17 Left 997804790 5:136906316-136906338 CCCCAGTAAGAACAGTATATATG No data
Right 997804796 5:136906356-136906378 CATAGGAGAATTAATCAGGAAGG No data
997804791_997804796 16 Left 997804791 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data
Right 997804796 5:136906356-136906378 CATAGGAGAATTAATCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997804796 Original CRISPR CATAGGAGAATTAATCAGGA AGG Intergenic
No off target data available for this crispr