ID: 997806646

View in Genome Browser
Species Human (GRCh38)
Location 5:136924520-136924542
Sequence ACTGATATGCAAGATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997806638_997806646 17 Left 997806638 5:136924480-136924502 CCACAGAATTGCTCTTTTCTTGA No data
Right 997806646 5:136924520-136924542 ACTGATATGCAAGATGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997806646 Original CRISPR ACTGATATGCAAGATGGGGA GGG Intergenic
No off target data available for this crispr