ID: 997808281

View in Genome Browser
Species Human (GRCh38)
Location 5:136941534-136941556
Sequence CAGTCTCAGCAAACTGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997808281_997808283 11 Left 997808281 5:136941534-136941556 CCTGTGTCAGTTTGCTGAGACTG No data
Right 997808283 5:136941568-136941590 CTATATCCATGTCCCCGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997808281 Original CRISPR CAGTCTCAGCAAACTGACAC AGG (reversed) Intergenic
No off target data available for this crispr