ID: 997808283 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:136941568-136941590 |
Sequence | CTATATCCATGTCCCCGCAA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
997808281_997808283 | 11 | Left | 997808281 | 5:136941534-136941556 | CCTGTGTCAGTTTGCTGAGACTG | No data | ||
Right | 997808283 | 5:136941568-136941590 | CTATATCCATGTCCCCGCAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
997808283 | Original CRISPR | CTATATCCATGTCCCCGCAA AGG | Intergenic | ||
No off target data available for this crispr |