ID: 997811771

View in Genome Browser
Species Human (GRCh38)
Location 5:136977623-136977645
Sequence ACAGGATTGCTGCAGCCAAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 321}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997811764_997811771 14 Left 997811764 5:136977586-136977608 CCCTTGAGTAGGTAAGGAAGGAA 0: 1
1: 0
2: 5
3: 22
4: 263
Right 997811771 5:136977623-136977645 ACAGGATTGCTGCAGCCAAGGGG 0: 1
1: 0
2: 1
3: 23
4: 321
997811765_997811771 13 Left 997811765 5:136977587-136977609 CCTTGAGTAGGTAAGGAAGGAAG 0: 1
1: 1
2: 6
3: 35
4: 334
Right 997811771 5:136977623-136977645 ACAGGATTGCTGCAGCCAAGGGG 0: 1
1: 0
2: 1
3: 23
4: 321
997811760_997811771 26 Left 997811760 5:136977574-136977596 CCTTAGAAAAAGCCCTTGAGTAG 0: 1
1: 0
2: 2
3: 16
4: 136
Right 997811771 5:136977623-136977645 ACAGGATTGCTGCAGCCAAGGGG 0: 1
1: 0
2: 1
3: 23
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997811771 Original CRISPR ACAGGATTGCTGCAGCCAAG GGG Exonic
900719027 1:4163204-4163226 AGAGGATTGCTTCAGCCTGGAGG - Intergenic
901639862 1:10687719-10687741 ACAGGATGGCTGCAGCCAGAGGG - Intronic
901936333 1:12629717-12629739 CCAGGATTCCTGAAGCCAGGTGG - Intergenic
902504985 1:16933654-16933676 ATAGGATTGCTGAACCCAGGAGG - Intronic
902932998 1:19744627-19744649 ACAGGATGGCTGCAGCAGGGAGG - Intronic
903510183 1:23868848-23868870 GCAGGATTGCTGCGGCAAAATGG - Intergenic
904345396 1:29864879-29864901 ACATGACTGCTGCAGCCAGGTGG + Intergenic
904472907 1:30746822-30746844 ACAGGATTGCTGAGGTCAAATGG + Intronic
905054982 1:35085578-35085600 AAAGGACAGCTGCAGCCAAAGGG - Intronic
905386814 1:37610631-37610653 AGAGGATCGCTTCAGCCTAGGGG + Intergenic
905993383 1:42359633-42359655 TAAGGCTTCCTGCAGCCAAGTGG + Intergenic
906441004 1:45844649-45844671 GCAGGATTGCTTGAGCCCAGGGG - Intronic
906975204 1:50562605-50562627 ACAGAGTTGCTGTACCCAAGGGG - Intronic
907867522 1:58412553-58412575 TCAGGATTGCAGTAGCCAAATGG + Intronic
908008674 1:59753254-59753276 TCAGATTTCCTGCAGCCAAGTGG + Intronic
908854249 1:68406463-68406485 GGAGGATTGCTTCAGCCAGGAGG + Intergenic
910675883 1:89816124-89816146 GGAGGATTGCTTGAGCCAAGAGG + Intronic
912445774 1:109735108-109735130 ACAGTCTTACTGCAGGCAAGTGG - Exonic
912645357 1:111386947-111386969 ACAGGGGTGCTGCAGACGAGGGG + Intergenic
913678247 1:121163162-121163184 ACAGAATTGCTGCTGTCATGTGG - Intergenic
914030087 1:143950802-143950824 ACAGAATTGCTGCTGTCATGTGG - Intronic
914159362 1:145117149-145117171 ACAGAATTGCTGCTGTCATGTGG + Intergenic
914903731 1:151727313-151727335 AGAGCTGTGCTGCAGCCAAGTGG - Intronic
916150237 1:161780939-161780961 ATAGGATTGCTTGAGCCCAGGGG - Intronic
916646065 1:166786161-166786183 ACTGGCTTACTGCAGCCAGGAGG + Intergenic
918762588 1:188431319-188431341 AGAGGATTGCTTGAGCCAGGAGG + Intergenic
920286249 1:204881938-204881960 ACAGGATTCCTGCTGCAAACAGG - Intronic
920465554 1:206181686-206181708 ACAGAATTGCTGCTGTCATGTGG - Intergenic
920697918 1:208195715-208195737 ACAGACTGGCTGCAGCCCAGGGG + Intronic
921268722 1:213448145-213448167 GGAGGATTGCTCCAGCCCAGAGG + Intergenic
921481653 1:215671111-215671133 ACAGGACCGCTGCAGCCAAATGG - Exonic
922302634 1:224315967-224315989 AGAGGATTGCTTGAGCCCAGGGG + Intronic
923905669 1:238381368-238381390 AAAACATTGCTGCTGCCAAGTGG - Intergenic
924485796 1:244482239-244482261 AGAGGATTGCTTGAGCCCAGGGG + Intronic
924505324 1:244677827-244677849 GGAGGATTGCTTCAGCCCAGGGG + Intronic
924947592 1:248856711-248856733 AGAGGATTGCTTGAGCCCAGGGG - Intronic
1063073936 10:2695533-2695555 CCAGGATGGCAGCAGGCAAGGGG + Intergenic
1063160257 10:3413453-3413475 AGAGGATTGCTTGAGCCCAGGGG + Intergenic
1063706344 10:8434672-8434694 AGAGGATTGCTTGAGCCCAGGGG - Intergenic
1064203644 10:13304601-13304623 AGAGGATTGCTTGAACCAAGAGG + Intergenic
1064777546 10:18795770-18795792 ACAGGAGTGCAGCAGACAGGAGG - Intergenic
1065568076 10:27036978-27037000 ACTTGACTGCTGCAGACAAGTGG + Intronic
1065919548 10:30380188-30380210 ACAGGATTGGCCCAGCCGAGCGG - Intergenic
1067693054 10:48516435-48516457 GGAGGATTGCTGGAGCCCAGAGG + Intronic
1068913797 10:62406820-62406842 ACAGGATAGCTGCAGACCTGAGG - Intronic
1068977877 10:63031157-63031179 AGAGGATTGCTTGAGCCCAGGGG - Intergenic
1070052202 10:72900229-72900251 AGAGGATTGCTTGAGCCCAGGGG + Intronic
1070838277 10:79465311-79465333 AGAGGATTGCTTGAGCCCAGGGG + Intergenic
1071108069 10:82121861-82121883 GGAGGATTGCTGGAGCCCAGGGG - Intronic
1071826813 10:89333607-89333629 AGAGGATTGCTTGAGCCCAGGGG + Intronic
1071850395 10:89563076-89563098 ATAGGAATGCTGTAACCAAGTGG - Intergenic
1073266195 10:102230011-102230033 CCGGGATTCCTGCAGCAAAGAGG - Intergenic
1073356195 10:102856322-102856344 GCAGGATTGCTTAAGCCCAGGGG + Intronic
1075534649 10:123260078-123260100 AAAGGCTTGCTGCAGTCCAGAGG + Intergenic
1075695637 10:124432994-124433016 AGAGGATGGCTTCAGCCCAGGGG + Intergenic
1075728531 10:124622982-124623004 ACAGAACTACTGCAGCCCAGAGG - Exonic
1075729306 10:124626865-124626887 GCAGGCTGGCTGCAGCCCAGAGG - Intronic
1076351455 10:129817547-129817569 GGAGGATTGCTTCAGCCCAGAGG - Intergenic
1076620232 10:131782564-131782586 ACAGTGTCGCTGTAGCCAAGAGG - Intergenic
1082042037 11:47694105-47694127 GCAGGATTGCTTCAGCTGAGAGG + Intronic
1083404497 11:62447231-62447253 ACAGGATTCTTCCAGCCAAGGGG - Intronic
1083676942 11:64331483-64331505 AGAGGATTGCTTGAGCCCAGGGG - Intergenic
1083913338 11:65723386-65723408 ACAGGTTTGCTATAGACAAGGGG - Intergenic
1084806484 11:71582704-71582726 ACAGGCTTGCAGCAGCAAATGGG + Exonic
1085039495 11:73318409-73318431 AGAGGATTGCTTGAGCCCAGGGG + Intronic
1085091764 11:73722435-73722457 AGAGGATTGCTTGAGCCAGGAGG - Intronic
1087360341 11:97150685-97150707 ACAGCAATGCTGCAGGTAAGTGG - Intergenic
1088240251 11:107766700-107766722 AGAGGATTGCTTGAGCCAGGAGG + Intergenic
1088299809 11:108344911-108344933 AGAGGATTGCTTGAGCCCAGGGG + Intronic
1088404069 11:109452390-109452412 ACAGGATTGCTTGAGTCAGGGGG + Intergenic
1088544655 11:110947316-110947338 AGGGGACAGCTGCAGCCAAGAGG + Intergenic
1093158795 12:15720376-15720398 GAAGGATTGCTGTAGCCCAGGGG - Intronic
1096346358 12:50850487-50850509 AGAGGATTGCTTGAGCCTAGGGG + Intronic
1097025480 12:56052240-56052262 ACAGGATCGCTTGAGCCCAGAGG + Intergenic
1098681573 12:73362446-73362468 ACAGGGTTAGTGCAGCCAAGGGG + Intergenic
1099005252 12:77227634-77227656 GCAGGGTAGCTGCAACCAAGTGG + Intergenic
1099116526 12:78632537-78632559 AGAGGATTGCTTGAGCCCAGGGG + Intergenic
1099479798 12:83151454-83151476 ACAGGATTGCGGCTGCAATGGGG - Intergenic
1101390611 12:104296497-104296519 AGAGGATTGCTTGAGCCCAGGGG - Intronic
1101804913 12:108055299-108055321 ATAGGATTTTTGCAGCCAACAGG - Intergenic
1101860383 12:108477773-108477795 ACAAGATGGCGCCAGCCAAGGGG + Intergenic
1101863588 12:108502738-108502760 GGAGGATTGCTGGAGCCCAGTGG + Intergenic
1102919864 12:116783710-116783732 ACAAGATTCCAGCAGCCAACAGG - Intronic
1105307722 13:19180865-19180887 GGAGGATTGCTGGAGCCCAGGGG + Intronic
1105450918 13:20499253-20499275 AGAGGATTGCTTGAGCCCAGGGG + Intronic
1105470053 13:20685333-20685355 AAAGGATTTCTGCAGCAATGTGG - Intronic
1106485071 13:30164908-30164930 ACAGGTTAACTCCAGCCAAGAGG - Intergenic
1108385776 13:49898141-49898163 GGAGGATTGCTTCAGCCCAGAGG - Intergenic
1108744182 13:53373877-53373899 ACAGGCTTTATGCAGCCTAGTGG + Intergenic
1108851411 13:54736195-54736217 AGAGGATTGCTTGAGCCCAGGGG - Intergenic
1110216461 13:73029833-73029855 AGAGGATTGCTTGAGCCAGGTGG + Intergenic
1111164473 13:84440786-84440808 ACATCATTGCTGCAGGCAAATGG + Intergenic
1111791438 13:92861284-92861306 ACAGAATTGCTGCATAAAAGTGG + Intronic
1115871536 14:37809701-37809723 AAAGGTTTGCTGCAGCCCACAGG - Intronic
1118000520 14:61518901-61518923 AGAGGATTGCTTGAGCCCAGGGG - Intronic
1118223357 14:63876185-63876207 GGAGGATTGCTTGAGCCAAGGGG + Intronic
1118677051 14:68198026-68198048 AGAAGATTGCTGCAACCATGAGG - Intronic
1119053949 14:71399493-71399515 TCAGGATTGCTTAAGCCCAGGGG - Intronic
1119130102 14:72164143-72164165 ACAGGACAGCTGTAGACAAGTGG - Intronic
1119427458 14:74545086-74545108 ACTGGAATTCTGCAGCCAAGAGG - Intronic
1122450557 14:101803116-101803138 AGAGGATTGCTTGAGCCCAGAGG + Intronic
1122858023 14:104569200-104569222 ACAGGATCTGTGCAGCAAAGGGG + Intronic
1123664898 15:22600200-22600222 GGAGGATTGCTTCAGCCAGGGGG + Intergenic
1123678734 15:22740143-22740165 GGAGGATTGCTTCAGCCCAGGGG - Intergenic
1124330941 15:28814426-28814448 GGAGGATTGCTTCAGCCCAGGGG - Intergenic
1124925088 15:34063197-34063219 AGAGGATTGCTGGGGCCCAGAGG - Exonic
1125493114 15:40163346-40163368 ACAGGATTGCTTAAGCTCAGCGG + Intronic
1125792150 15:42375077-42375099 AGAGGATTGCTTGAGCCGAGGGG - Intronic
1127382967 15:58445353-58445375 ACAGGCTGGCTTCAGCCAGGGGG + Intronic
1127771434 15:62234272-62234294 AAAGGATTGCTTGAGCCCAGGGG + Intergenic
1128109737 15:65068674-65068696 CCAGAATTGCTGTAGGCAAGAGG - Intronic
1131484871 15:92811744-92811766 GGAGGATTGCTTCAGCCCAGGGG - Intergenic
1132706652 16:1246813-1246835 AGAGGATTGCTTGAGCCCAGGGG + Intergenic
1132735459 16:1383831-1383853 ACAGGGCTGCTGGAGCCACGTGG - Intronic
1133818207 16:9214184-9214206 ACAGGAGAGCTGCAGCAGAGGGG - Intergenic
1134205295 16:12232725-12232747 CCAGGATGGCTGCAGCCTAGAGG + Intronic
1134485920 16:14658336-14658358 ACAAGATAGCACCAGCCAAGGGG - Intronic
1134742454 16:16560024-16560046 GGAGGATTCCTGGAGCCAAGTGG - Intergenic
1134925109 16:18152435-18152457 GGAGGATTCCTGGAGCCAAGTGG + Intergenic
1135031742 16:19044276-19044298 AGAGGATTGCTTGAGCCCAGAGG - Intronic
1135354137 16:21755600-21755622 AGAGGATTGCTTGAGCCCAGGGG - Intronic
1135452626 16:22571741-22571763 AGAGGATTGCTTGAGCCCAGGGG - Intergenic
1135489560 16:22897418-22897440 ACAATATTGGTGCAGCCAAAGGG - Intronic
1135659768 16:24285932-24285954 AGAGGATTGCTTAAGCCTAGTGG - Intronic
1135775812 16:25257120-25257142 ACAGCCATGCTGCAGCCCAGGGG + Exonic
1135895239 16:26395232-26395254 ACAGGATTCTTACAACCAAGTGG + Intergenic
1136448969 16:30341802-30341824 GGAGGATTGCTTCAGCCTAGGGG + Intergenic
1136564853 16:31063747-31063769 ACAGCGTTGCTGCAGCCAATGGG - Intronic
1136589146 16:31206856-31206878 GCAAGATTGCTTGAGCCAAGGGG - Intergenic
1138541551 16:57690646-57690668 AGAGGATTGCTTGAGCCCAGGGG + Intergenic
1138964075 16:62062996-62063018 GGAGGATTGCTTAAGCCAAGGGG - Intergenic
1139290587 16:65854815-65854837 GCAGGATTGCTTGAGCCCAGGGG + Intergenic
1139440134 16:66962531-66962553 AAAGGATTGCTTGAGCCCAGGGG + Intronic
1140502944 16:75450747-75450769 GGAGGATTGCTGGAGCCAGGAGG - Intronic
1140576687 16:76178669-76178691 GGGGGATTGCTTCAGCCAAGAGG + Intergenic
1141466078 16:84206620-84206642 CCGGGAATGCTGCAGCCCAGTGG + Intergenic
1144236837 17:13269807-13269829 ACAGGATTCCTTCAGTCAATGGG + Intergenic
1148042570 17:44720452-44720474 ACAGGATTGCAGCTGCAATGGGG + Intronic
1148371596 17:47103748-47103770 GCAGGATTGCTTGAGCCCAGGGG + Intergenic
1148515969 17:48217554-48217576 AGAGGATAGCTTGAGCCAAGAGG + Intronic
1150165118 17:62933816-62933838 ACAGGATTGGTGCAGCAAGGAGG + Intergenic
1150298674 17:64030228-64030250 GGAGGATTGCTTAAGCCAAGAGG - Intergenic
1151432265 17:74071526-74071548 ACAGGAGTGCTGCTGTCCAGGGG + Intergenic
1151991418 17:77577410-77577432 ACAGAAATGCTGCAGGCAAAAGG + Intergenic
1152772271 17:82177452-82177474 GGAGGATTGCTTCAGCCTAGGGG + Intronic
1152900638 17:82939206-82939228 ACAGCAGGGCTGCAACCAAGAGG - Intronic
1153677669 18:7469785-7469807 GGAGGATTGCTTAAGCCAAGAGG + Intergenic
1155725826 18:29081931-29081953 ACAGGAATGCTGGATCCGAGAGG - Intergenic
1157488292 18:48105050-48105072 ACAGGATAGCTGCCCCCACGGGG + Intronic
1157701153 18:49762217-49762239 GCAGGATTGCTGCCGCGTAGGGG + Intergenic
1158380646 18:56926275-56926297 ACATGGCAGCTGCAGCCAAGGGG - Intronic
1159882762 18:73875022-73875044 AGAGGATGCCTGCAGCCATGTGG - Intergenic
1160239193 18:77111035-77111057 ACAGGACTGGAGCAGCCACGAGG - Intronic
1160390491 18:78527677-78527699 GCAGGAGTGCTGAAGCCAGGCGG - Intergenic
1160948415 19:1654214-1654236 GCAGGATGGCTGGAGCCAAGCGG - Intergenic
1161352525 19:3801891-3801913 ACAGGATTCCTGCCACCAGGTGG - Intronic
1161910720 19:7191736-7191758 GGAGGATTGCTACAGCCCAGGGG + Intronic
1161933090 19:7354224-7354246 AGAGGATTGCTTGAGCCAACGGG + Intronic
1162301078 19:9845548-9845570 AGAGGATTGCTGCAGCCCAGGGG + Intronic
1163310128 19:16509292-16509314 TCAGGATTCCTGCAGCCCCGTGG + Intronic
1163442954 19:17330716-17330738 ACAGGATTGTTTCATCAAAGAGG - Intronic
1163454549 19:17398872-17398894 TGAGGATTGCTGGAGCCCAGGGG + Intergenic
1163854804 19:19692951-19692973 ACAGGATTGCTTGAGCCAGGAGG + Intergenic
1163933010 19:20416355-20416377 GCAGGAGTGCTGTAGCCCAGTGG - Intergenic
1165235805 19:34420699-34420721 AGAGGATTGCTTGAGCCCAGGGG + Intronic
1165998500 19:39863013-39863035 AGAGGATTGCTTGAGCCTAGGGG - Intergenic
1166336323 19:42110170-42110192 GGAGGATTGCTTCAGCCAGGAGG + Intronic
1166569064 19:43782119-43782141 GGAGGATTGCTGGAGCCCAGGGG + Intergenic
1167013788 19:46826348-46826370 AGAGGATTGCTTGAGCCCAGGGG + Intergenic
1167124934 19:47543047-47543069 AGAGGATTGCTTGAGCCCAGGGG + Intronic
926829727 2:16948275-16948297 ACAAGATGGCGCCAGCCAAGTGG - Intergenic
927790829 2:26008277-26008299 AGAGGATTGCTTGAGCCCAGGGG + Intergenic
927988497 2:27429845-27429867 ACAGGAAAGCTGTAGCCAATGGG - Intronic
928676097 2:33653522-33653544 AGAGGATTGCTTGAGCCCAGAGG - Intergenic
929082905 2:38138766-38138788 ACAGGTCTGCTGGAGACAAGTGG - Intergenic
929765951 2:44844158-44844180 AAAGGATTGTTCCAGCCAAGGGG + Intergenic
930621751 2:53651455-53651477 ACAAGATGGCACCAGCCAAGTGG + Intronic
932818440 2:74879907-74879929 ACAGGGCTGCTCCAGCAAAGAGG + Intronic
933234038 2:79844618-79844640 ACAGGATTTCTGAGGCCAAGAGG - Intronic
934977636 2:98815944-98815966 GCAGGGATGCTGCCGCCAAGAGG + Intronic
937305761 2:120869538-120869560 AGAGGAATGCTGGACCCAAGTGG - Intronic
939589499 2:144046474-144046496 AGAGGATTGCTTGAGCCCAGGGG - Intronic
939896707 2:147800518-147800540 ACAGATTTGCTGCTGGCAAGGGG - Intergenic
940255754 2:151726957-151726979 GGAGGATTGCTTCAGCCCAGGGG + Intronic
942872548 2:180752995-180753017 GGAGGATCGCTGCAGCCCAGGGG - Intergenic
943422291 2:187681473-187681495 ACTGACTTGCTGCAGGCAAGTGG - Intergenic
944972899 2:205014419-205014441 AAAGGAGAACTGCAGCCAAGGGG + Intronic
946437245 2:219665442-219665464 ATAGGATGGCTCCAGCCAGGAGG + Intergenic
947163710 2:227240290-227240312 CCAGGTTTGCAGCAGCCAGGGGG - Intronic
948072058 2:235135680-235135702 CCAGGGTTGCTGCATCCAAATGG + Intergenic
948111793 2:235462221-235462243 AGAGGATTGCTTCAGCCCAGAGG - Intergenic
948634936 2:239328965-239328987 GCAGGTTCGCAGCAGCCAAGTGG - Intronic
949003145 2:241628847-241628869 AGAGGATCGCTGGAGCCCAGGGG + Intronic
1168796335 20:612210-612232 ACAGGCCTTCTGCAGCCGAGAGG + Intergenic
1169501028 20:6161007-6161029 ACGGTAATGCTGCAGCCATGGGG - Intergenic
1169988484 20:11473340-11473362 ACAAGATGGCCTCAGCCAAGGGG + Intergenic
1170297605 20:14845710-14845732 ACAGCATTGCTTCAACCAAGAGG + Intronic
1170534335 20:17325017-17325039 ACCTGAATTCTGCAGCCAAGAGG - Intronic
1170580434 20:17695219-17695241 AGAGGATTGCTTGAGCCCAGGGG + Intronic
1171095713 20:22330851-22330873 GCAGAATTACTGCAGGCAAGGGG - Intergenic
1173343370 20:42175303-42175325 ACAGTGTGGCTGCAGCCTAGAGG - Intronic
1175329657 20:58154895-58154917 ACAGGATGGCTTCAGCCTGGAGG - Intronic
1175832899 20:61976744-61976766 GCAGGAATTCAGCAGCCAAGCGG - Intronic
1176269657 20:64229453-64229475 ACAAGAGTTCTGCAGCCGAGTGG + Intronic
1177074477 21:16554803-16554825 ACAGAATTGCCGCAGCCGGGCGG - Intergenic
1177314509 21:19439672-19439694 GAAGGATTGCTTCAGCCCAGGGG + Intergenic
1177391519 21:20480011-20480033 TGAGGATGGCTGCAGCCAGGTGG - Intergenic
1178037680 21:28603011-28603033 CCATGATGGCTGCAGGCAAGTGG - Intergenic
1180060654 21:45383335-45383357 ACAGGATTCCTGCAGCAGAGAGG - Intergenic
1180937518 22:19635707-19635729 ACAGGATCACTTGAGCCAAGGGG + Intergenic
1181014619 22:20061935-20061957 AGAGGCTTGATGCAGCCACGTGG + Intronic
1181140596 22:20801923-20801945 ACAGCAGTGCTCCAGACAAGCGG - Intronic
1181464359 22:23102768-23102790 ACAGCAGTGCAGCAGCCAGGAGG + Intronic
1182387485 22:29957540-29957562 GGAGGATTGCTGTAGCCCAGGGG - Intronic
1184266825 22:43351921-43351943 ACAGGATTCCTGCATTCATGGGG + Intergenic
1185159599 22:49215259-49215281 CCAGCCTCGCTGCAGCCAAGGGG - Intergenic
950835537 3:15915263-15915285 AGAGGATTGCTTGAGCCCAGGGG + Intergenic
952271056 3:31831844-31831866 ACGGGATTGCTGGAGCCAGGGGG - Intronic
952326273 3:32323072-32323094 CCAGGGATGCTGCAGCCAAGGGG + Intronic
952506871 3:34015450-34015472 ACTGGAGGGCTGCAGCAAAGTGG + Intergenic
953447333 3:42979467-42979489 ACACGTTCTCTGCAGCCAAGTGG - Intronic
955174109 3:56596003-56596025 GCAGGATTGCTTGAGCCCAGGGG - Intronic
957521361 3:81322597-81322619 GCAGGATTGCTCCAGCCAGCAGG - Intergenic
958597865 3:96253133-96253155 AGAGGATTGCTTGAGCCCAGGGG + Intergenic
960430029 3:117557980-117558002 TAAGGATTGCAGCAGCCAACTGG + Intergenic
960630138 3:119722077-119722099 GCAGGATTGCTTGAGCCCAGGGG + Intronic
961415415 3:126753162-126753184 ACACGATTTTGGCAGCCAAGGGG + Intronic
964782140 3:160351975-160351997 ACATTTTTGCTGCAGCAAAGTGG + Intronic
964951924 3:162306023-162306045 ACAGAATTGCTCCATCCAACTGG + Intergenic
966288090 3:178321174-178321196 ACAGGCTTGCTGGAGTCATGTGG - Intergenic
966554252 3:181241400-181241422 ACATGGATGCTGCAGCCAAATGG + Intergenic
966661650 3:182421005-182421027 ACATGCTTGCTGAAGGCAAGGGG + Intergenic
968794414 4:2692975-2692997 AGAGGATTGCTTGAGCCCAGGGG + Intronic
968922078 4:3527507-3527529 ACAGGGTAGCAGCAGCCACGGGG - Intronic
970397089 4:15679876-15679898 AAAGAATTGCTGGATCCAAGAGG - Intronic
970469598 4:16363714-16363736 AGAGAATTGCTGCAGCTAAATGG + Intergenic
971015258 4:22482572-22482594 AGAGGATTGCTCAAGCCCAGGGG + Intronic
971673056 4:29589416-29589438 ACTTGATTGCTGCTGCCAATTGG + Intergenic
972536725 4:40006204-40006226 ACAAGATGGCTCCAACCAAGGGG - Intergenic
973711279 4:53632450-53632472 ACACTCTTGCTTCAGCCAAGAGG + Intronic
973737731 4:53888950-53888972 ACAGGACAGCAGCAGCCCAGTGG + Intronic
974031402 4:56779917-56779939 GGAGGATTGCTGGAGCCCAGGGG + Intergenic
974191884 4:58515548-58515570 AAAGGATAGATGGAGCCAAGTGG + Intergenic
975063762 4:70037473-70037495 ACAGGATGGCTGCCGGGAAGAGG - Intergenic
975810891 4:78168435-78168457 ACAGGGGTGCTGCAGGGAAGTGG - Intronic
976965794 4:91039116-91039138 GGAGGATTGCTTGAGCCAAGTGG - Intronic
977098372 4:92774819-92774841 AGAGGATTGCTTGAGCCCAGAGG - Intronic
980116163 4:128680952-128680974 AGAGGATTGCTTGAGCCAAGGGG - Intergenic
982032016 4:151310281-151310303 AGAGGATTGCTTGAGCCTAGTGG + Intronic
983351900 4:166601230-166601252 AATGGAGTGCTGCAACCAAGGGG - Intergenic
983921591 4:173351398-173351420 GAAGGATTGCTGGAACCAAGAGG + Intergenic
984007382 4:174329035-174329057 GGAGGATTGCTTGAGCCAAGGGG - Intronic
984869859 4:184316374-184316396 GGAGGATTGCTGGAGCCCAGGGG - Intergenic
984981212 4:185283356-185283378 ACAGGATTTCAGCAGATAAGGGG + Intronic
985677011 5:1237425-1237447 ACAGGGTAGGTGCAGCCAGGTGG + Intronic
988534689 5:32056421-32056443 ACAGCATTGCTGTAGAGAAGAGG - Intronic
989369386 5:40690247-40690269 GGAGGATTGCTGGAGCCTAGGGG + Intronic
989484478 5:41973449-41973471 AGAGGATTGCTTGAGCCCAGGGG + Intergenic
992776276 5:80091891-80091913 AGAGGATTGCTGCCCCCTAGTGG - Intergenic
993351711 5:86857866-86857888 AGAGGATTGCTTGAGCCCAGGGG - Intergenic
994903520 5:105805763-105805785 AGAGGATTGCTCAAGCCAGGAGG - Intergenic
995210286 5:109530168-109530190 AGAGGATTGCTTCAGCTCAGGGG - Intergenic
995714055 5:115064517-115064539 ACTGGATTGCTGTAACCAACTGG - Intergenic
996396235 5:123016847-123016869 AAAGGATTTCTCCAGCCACGTGG - Intronic
997046506 5:130325462-130325484 AATAGAGTGCTGCAGCCAAGAGG - Intergenic
997811771 5:136977623-136977645 ACAGGATTGCTGCAGCCAAGGGG + Exonic
997811940 5:136979103-136979125 ACAGAACTGCTGCAGACAAAGGG - Intronic
997831824 5:137157035-137157057 ACAGGATGGAGGCAGCCATGGGG - Intronic
997971696 5:138408110-138408132 ACAAGATGGCACCAGCCAAGGGG + Intronic
999222781 5:149995266-149995288 ACATGATTGCTGCAGCGTGGTGG - Exonic
999981995 5:156966747-156966769 ACAGGATTGCTTGAGCCTGGAGG - Intergenic
1002326863 5:178415479-178415501 ACAGGCTTGCTGCTGCCAGCCGG + Intronic
1004387181 6:15183328-15183350 AAAGGATTGCTTGAGCCCAGGGG - Intergenic
1005275690 6:24215285-24215307 ACAGCCTTGCTGCAGCCACACGG - Intronic
1009043856 6:58214122-58214144 ACCTAATTGCTGCAGCCAACAGG - Intergenic
1009219691 6:60968379-60968401 ACCTAATTGCTGCAGCCAACAGG - Intergenic
1009416666 6:63423253-63423275 AGGGGATTGCTCCAGCCAGGAGG + Intergenic
1010434562 6:75814253-75814275 CCACCATTGCTGCTGCCAAGGGG + Intronic
1011634441 6:89357938-89357960 ACAGTAATTCTGCAGCCATGGGG + Intergenic
1012103906 6:95128341-95128363 ATTGGATTGCTACAGCAAAGAGG - Intergenic
1013049385 6:106517234-106517256 GGAGGATTGCTTGAGCCAAGGGG - Intronic
1013093367 6:106921357-106921379 AGAGGATTGCTTGAGCCCAGGGG + Intergenic
1013331235 6:109102286-109102308 GCAGGACTGCTTGAGCCAAGGGG - Intronic
1014341402 6:120212121-120212143 ACAGGATTGCTTCACTCTAGGGG - Intergenic
1015600639 6:134906897-134906919 GGAGGATTGCTGGAGCCCAGGGG - Intergenic
1015750742 6:136555822-136555844 ACAGGATTGCTTGAGCCTAAGGG + Intergenic
1015809937 6:137152120-137152142 GAAGGATTGCTGGAGCCCAGGGG + Intronic
1016485706 6:144535868-144535890 AGAGGATTGCTTGAGCCCAGGGG - Intronic
1017041898 6:150314658-150314680 CCAAGACTGCTGCAGCTAAGAGG - Intergenic
1017257378 6:152349072-152349094 ACAGAAATGTTGCAGCCCAGAGG + Intronic
1019596626 7:1861302-1861324 AAAGGATAGCTTCAGCCAGGTGG - Intronic
1022168101 7:27792870-27792892 AGAGGATTGCTTGAGCCAGGAGG + Intronic
1022824607 7:33996062-33996084 ACATGGTTGCTGCAGCAAATAGG + Intronic
1024322325 7:48083732-48083754 ACAGGATTCCAGCTGCCCAGAGG - Intergenic
1025776865 7:64568324-64568346 ACAGGACAGCTGGAGCCAGGGGG + Intergenic
1025921864 7:65920768-65920790 AGAGGATTGCTTGAGCCCAGGGG + Intronic
1025941097 7:66076582-66076604 CCAGGGTTGCTGGAGCCACGAGG - Intronic
1026517663 7:71086868-71086890 ACAAGATGGCTGCGGCCAAGGGG - Intergenic
1026644118 7:72153182-72153204 GTAAGATTGCTGCAGCCAAGGGG - Intronic
1026911610 7:74094635-74094657 AAAGGAGTGCTGCAGCCGGGAGG - Intronic
1027526571 7:79276872-79276894 GGAGGATTGCTTGAGCCAAGAGG + Intronic
1027948543 7:84781315-84781337 GCAGGATAGATGCAGCCAGGAGG - Intergenic
1028400340 7:90418719-90418741 AGTGGAGTGCTGGAGCCAAGTGG + Intronic
1029130419 7:98326061-98326083 AGAGGATTGCTTGAGCCCAGGGG + Intronic
1029264027 7:99324793-99324815 AGAGGATTGCTTGAGCCCAGGGG + Intergenic
1029467503 7:100735474-100735496 GGAGGATTGCTGGAGCCCAGAGG + Intronic
1034658109 7:152745363-152745385 AAAGGATAGCTGCTGCCAGGAGG + Intergenic
1036025835 8:4907789-4907811 AGAGGATTGCTTGAGCCCAGGGG - Intronic
1036499151 8:9297415-9297437 AGAGGATTGCTTGAGCCCAGTGG + Intergenic
1037420872 8:18701054-18701076 AGAGGATTGCTTAAGCCAGGAGG - Intronic
1037940149 8:22945137-22945159 AGAGGATTGCTTGAGCCCAGAGG - Intronic
1038291496 8:26253443-26253465 AAAGGATTGCTCGAGCCCAGGGG + Intergenic
1042870823 8:73397591-73397613 GAAGGATTGCTTCAGCCCAGGGG + Intergenic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1047126567 8:121968724-121968746 AAAGGAATGCTGGAGCAAAGAGG + Intergenic
1048383457 8:133889078-133889100 ACAGGAGCGCTGCAGCTGAGTGG + Intergenic
1050057427 9:1670458-1670480 ACAGACTTGCAGCACCCAAGGGG + Intergenic
1051699786 9:19809650-19809672 ACAGGATGGCAGGAGCCAAGGGG + Intergenic
1052008586 9:23380022-23380044 GGAGGATTGCTTCAGCCCAGGGG + Intergenic
1052291938 9:26852147-26852169 GGAGGATTGCTTCAGCCAGGAGG - Intronic
1053083259 9:35195104-35195126 ACAAGATGGCATCAGCCAAGGGG - Intronic
1053610575 9:39709301-39709323 CCAGGATGGCAGGAGCCAAGGGG + Intergenic
1054087678 9:60761856-60761878 CCAGGATGGCAGGAGCCAAGGGG - Intergenic
1054242948 9:62633094-62633116 CCAGGATGGCAGGAGCCAAGGGG - Intergenic
1054460559 9:65460028-65460050 ACAGGCTTCCTGCAAGCAAGGGG - Intergenic
1054557072 9:66667612-66667634 CCAGGATGGCAGGAGCCAAGGGG - Intergenic
1054917152 9:70505704-70505726 GGAGGATTGCTTCAGCCCAGGGG - Intergenic
1056630737 9:88291012-88291034 ACGGGATTGCTGAAGACAGGTGG - Intergenic
1059109155 9:111538397-111538419 AGAGGATTGCTTGAGCCCAGGGG + Intronic
1059165830 9:112075652-112075674 GAAGGATTGCTACAGCCCAGGGG + Intronic
1060051569 9:120382211-120382233 CCAGGCTGGCTGCAGGCAAGCGG + Intergenic
1060743656 9:126115980-126116002 AGAGGATTGCTTGAGCCCAGGGG - Intergenic
1060893842 9:127204985-127205007 GCATGTCTGCTGCAGCCAAGGGG - Intronic
1062252617 9:135605824-135605846 GGAGGATCGCTTCAGCCAAGGGG + Intergenic
1185513805 X:683331-683353 GGAGGATTGCTGCAGCCCCGAGG - Intergenic
1185736312 X:2499543-2499565 GGAGGATTGCTGCAGGCCAGGGG + Intronic
1185932151 X:4215242-4215264 GGAGGATTGCTTGAGCCAAGGGG - Intergenic
1187072998 X:15907235-15907257 GGAGGATTGCTGGAGCCCAGGGG + Intergenic
1188002013 X:24991591-24991613 ACAGGCTTGCTGCAGCCTGGTGG - Intronic
1188779674 X:34266047-34266069 TCATGCTTGCTGCAGCCAATTGG - Intergenic
1193849166 X:86514707-86514729 ACAGGAGTGCTGCACCCTATAGG - Intronic
1194482437 X:94442598-94442620 ACAAGATGGCACCAGCCAAGGGG - Intergenic
1194805173 X:98318317-98318339 GAAGGATTGCTGGAGCCCAGAGG + Intergenic
1195018105 X:100798297-100798319 ACCTGATTGCTGCACCCAATCGG - Intergenic
1195343764 X:103928443-103928465 ACATGATCCCTGCAGCCCAGTGG - Intronic
1199972490 X:152871527-152871549 TCAGTCTTGCAGCAGCCAAGGGG - Intergenic