ID: 997811789

View in Genome Browser
Species Human (GRCh38)
Location 5:136977864-136977886
Sequence CAGACCTGGAACAAAATTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997811789 Original CRISPR CAGACCTGGAACAAAATTTC TGG (reversed) Exonic
900830444 1:4961515-4961537 CAGACCAGGAAAGAAATTGCTGG + Intergenic
900920783 1:5668862-5668884 CAGAAGTGGAACAAAGGTTCAGG + Intergenic
903954433 1:27015318-27015340 CAGACCTGGAACTAAAACCCAGG + Intergenic
904028767 1:27521031-27521053 CAGAGCTGGAACAAGACCTCAGG - Intergenic
906161407 1:43651529-43651551 CAGGCCTGTAACTAGATTTCTGG + Intronic
907230972 1:52998255-52998277 ATAACCTGGAGCAAAATTTCTGG + Intronic
909649868 1:77962245-77962267 CAGACCTGACTCAAAATGTCTGG - Intronic
909714960 1:78696883-78696905 CACAACTTCAACAAAATTTCAGG - Intergenic
910326689 1:86016857-86016879 GAGGCTTGGAACCAAATTTCAGG - Intronic
911266286 1:95748361-95748383 CATTCCTGGAAGACAATTTCTGG - Intergenic
911414624 1:97556083-97556105 CAGACAAAGAACAAAATTTAAGG + Intronic
912403620 1:109417843-109417865 CATAACAGAAACAAAATTTCAGG + Intronic
913303766 1:117401331-117401353 CAGAGCTTGAATTAAATTTCTGG + Intronic
916828767 1:168469561-168469583 GGGACTTGGAACAAACTTTCTGG + Intergenic
917385846 1:174473144-174473166 CAGCCATGGAACATAATTTTAGG + Intronic
918152049 1:181806067-181806089 CAGGTCTGGAAGAAAATTTTGGG - Intronic
918339833 1:183559124-183559146 CAGACCTGAATCAGAATCTCTGG + Intronic
918363184 1:183779693-183779715 CAGACCTAGAGCAAACTTTGGGG - Intronic
919084246 1:192902345-192902367 CAGACCTGGTACCACATTCCAGG - Intergenic
920867369 1:209764110-209764132 CAGATCTGCAACTAAAATTCAGG + Intronic
922668031 1:227489356-227489378 GTGACCTGGCTCAAAATTTCCGG + Intergenic
922997764 1:229979947-229979969 AGGACCTGGAACAACATTGCTGG + Intergenic
923467648 1:234263604-234263626 CAGACCTGAAACAGAAACTCTGG + Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1064772988 10:18743522-18743544 TATACCTAGAACAAAATGTCTGG - Intergenic
1068396073 10:56463976-56463998 CAGAACTGGAATTAAAATTCAGG - Intergenic
1072459221 10:95604317-95604339 CAGAGCTGGAAAAAAAATTCTGG + Intergenic
1073643779 10:105278678-105278700 CAGCCATGGAAGAAAATTCCTGG - Intergenic
1074871751 10:117582526-117582548 CATACCTGGAACCCAAATTCAGG + Intergenic
1074898206 10:117794990-117795012 CAGACCACGGACAAAATCTCAGG + Intergenic
1075414461 10:122252225-122252247 CAAGCCTGGAACACAAATTCAGG - Intronic
1077748984 11:4942388-4942410 TAGACCTGAATCAAAATTACAGG + Intronic
1077882577 11:6363093-6363115 CAGACCTTGATCAAACTCTCTGG - Intergenic
1079430327 11:20383432-20383454 CAAACTTGAATCAAAATTTCTGG + Exonic
1079827011 11:25209164-25209186 CACACCTAGAACAATATATCTGG + Intergenic
1080710883 11:34747081-34747103 CAGACCTAGACCTAACTTTCTGG + Intergenic
1083379915 11:62258162-62258184 TAGACCTCCAACAAAAATTCTGG + Intergenic
1085929234 11:81060872-81060894 CAAAAATGGAACAAAATTTATGG + Intergenic
1086778743 11:90875567-90875589 GAGACTTGAAACAAGATTTCTGG + Intergenic
1087094057 11:94303617-94303639 CAGAGCTGGGATATAATTTCAGG - Intergenic
1087740256 11:101879409-101879431 GAGACCTGCCACAAATTTTCAGG + Intergenic
1088245319 11:107812719-107812741 CATAACAGAAACAAAATTTCTGG + Intronic
1088305387 11:108401882-108401904 CAGACCATTAACATAATTTCTGG + Intronic
1088988613 11:114930927-114930949 AAGACCTGGAGCAAAGCTTCAGG + Intergenic
1095261995 12:40107644-40107666 CAGACCTCGGACAATATTGCAGG + Intergenic
1095528764 12:43159699-43159721 CAGGCCTGGAACAAGTCTTCTGG + Intergenic
1097319922 12:58214043-58214065 CAGACCAGCAATAAAATTTTAGG - Intergenic
1099595615 12:84660790-84660812 CAGATCTGGAAAAAAATAACAGG + Intergenic
1100764898 12:97853239-97853261 CAGAGCTGGAACTAGAATTCAGG - Intergenic
1101040683 12:100752381-100752403 CAAACCTGAAAAAAAATTTAAGG + Intronic
1102289533 12:111687797-111687819 CAGAGCTGGAACTGAAATTCAGG + Intronic
1103379274 12:120481325-120481347 CAGACCCTGAACAAAAGTTAAGG + Intronic
1104094906 12:125548156-125548178 CACACCTGGAAAAAGAGTTCTGG + Intronic
1105826549 13:24128305-24128327 CAGACCTGGCAGAGCATTTCTGG - Intronic
1107828711 13:44354445-44354467 CAGACCTGGACTTAAATTCCAGG + Intergenic
1108757893 13:53526283-53526305 CAGATCAGGTACAATATTTCTGG - Intergenic
1113060489 13:106317069-106317091 AAGACCTGGAGCAAGAATTCAGG - Intergenic
1116411240 14:44626202-44626224 TACACCTGGCATAAAATTTCAGG + Intergenic
1116913589 14:50498044-50498066 CAGAGCAGGAACAAAGTTTGTGG - Intronic
1118602729 14:67481918-67481940 CAGCCCAGGAACAGAAATTCAGG + Intronic
1118631318 14:67706318-67706340 GAGACCTGTCACAAATTTTCTGG - Intronic
1121224747 14:92313074-92313096 AAGACCTTGAATATAATTTCTGG - Intergenic
1122024147 14:98862768-98862790 CAGAACTGGAACTCAAATTCAGG - Intergenic
1122710100 14:103650224-103650246 CTGACCTGGAACAATAGTACAGG - Intronic
1125041266 15:35190058-35190080 CAGTGCTGGAATAAAATTTCAGG + Intergenic
1125041274 15:35190113-35190135 CAGTACTGGAATAAAATTTCAGG + Intergenic
1125281541 15:38047098-38047120 CAGAGCTGAATCAAAATTTCAGG - Intergenic
1126683744 15:51228843-51228865 CAGCTGTGAAACAAAATTTCAGG - Intronic
1126961622 15:54002936-54002958 CAGAGCTGGAACAAAAACGCAGG - Intergenic
1127106595 15:55623085-55623107 CAGAAGTATAACAAAATTTCAGG - Intronic
1127367959 15:58309291-58309313 CAGAGCTGGGACAAAATCTCAGG - Intronic
1128375017 15:67067841-67067863 CAGAGCTGGAACCAAATCCCAGG - Intronic
1128601981 15:69002772-69002794 GAGACATTGACCAAAATTTCAGG + Intronic
1128988166 15:72236340-72236362 AAGACCTAGAAAAAAAGTTCAGG - Intergenic
1129163682 15:73762819-73762841 CAGACCTGGAAACAAATCTGGGG - Intergenic
1129947659 15:79554664-79554686 CAGACCTGGAACTGAATGGCTGG - Intergenic
1130247994 15:82271273-82271295 CTAACCTGGAAGGAAATTTCAGG - Intronic
1132397317 15:101483354-101483376 CATACCTGGCCCAGAATTTCAGG - Intronic
1133844544 16:9441705-9441727 CAGAGGTGAAATAAAATTTCAGG + Intergenic
1138777639 16:59743530-59743552 CAGACCTGGAACAGATGTGCAGG - Intronic
1140045343 16:71436922-71436944 CAGCCCTGAATCAGAATTTCTGG - Intergenic
1140973928 16:80041268-80041290 GAGACATTGTACAAAATTTCTGG + Intergenic
1141233584 16:82194654-82194676 CAGATATGAAACAAAATTTTAGG - Intergenic
1143647200 17:8238440-8238462 CAGACTTGGAACAAGAGTGCAGG - Exonic
1146113066 17:30109405-30109427 CGGACCTAGCACATAATTTCTGG + Intergenic
1146466791 17:33092566-33092588 CAGACCTATATCAGAATTTCTGG - Intronic
1146658403 17:34648825-34648847 CAGTCCTGGATCAAATCTTCAGG - Intergenic
1148114190 17:45165312-45165334 CAGACCCCGAAGAGAATTTCAGG - Intronic
1150749421 17:67846501-67846523 GAGACCTGAACAAAAATTTCAGG - Intronic
1152263367 17:79279075-79279097 CAGAGCTGGGACTAAAATTCTGG + Intronic
1153466092 18:5389410-5389432 CAAACCTATAACAAAATTTGGGG + Intergenic
1153938670 18:9956213-9956235 CAGAGCTGGAACTAGATATCTGG + Intronic
1157993475 18:52526183-52526205 CTGACAGGGAACAAAATTTCTGG + Intronic
1159233103 18:65634608-65634630 CAGACCTTGAGCCACATTTCTGG + Intergenic
1160413510 18:78690323-78690345 CAGACCAGGAACAAAACAGCAGG + Intergenic
1160473277 18:79158831-79158853 CAGACCTAGAACAAAATCTATGG - Intronic
1163218640 19:15898505-15898527 CAGAGATGGAACATTATTTCTGG - Intergenic
1163927878 19:20362674-20362696 CGGACCTGGAAAAATTTTTCAGG - Intergenic
1163957581 19:20658626-20658648 CAGACCTGGAACAAAGCTCTGGG - Intronic
1166767586 19:45261248-45261270 CAGACAAGAAACAAAATTACAGG + Intronic
925995785 2:9292017-9292039 CAGAGCTGGAACAAGAACTCGGG - Intronic
926279645 2:11435357-11435379 CATTCTTGGCACAAAATTTCAGG + Intergenic
927382652 2:22497025-22497047 GAGACCAGGAATAAAATTTCAGG + Intergenic
927392942 2:22616114-22616136 CAGACCTGAGACTAAATTTGAGG + Intergenic
928195242 2:29211352-29211374 TAGACCAGGAACAATATTTATGG + Intronic
931432474 2:62219235-62219257 TAGACCTTTACCAAAATTTCTGG - Intronic
931755705 2:65372232-65372254 CAGTCCAGGAACAGAATTTACGG - Intronic
935154817 2:100474873-100474895 TGGACCTGGAGCAAAAATTCAGG + Intronic
935649529 2:105370401-105370423 CAACCCTGCAACCAAATTTCTGG - Intronic
938913667 2:135911938-135911960 CAGACCAAGTAAAAAATTTCTGG - Intronic
939570505 2:143834687-143834709 CAGGCCTGGAAAAATATTACTGG - Intergenic
939846847 2:147256878-147256900 TAGTCCTGGAACAAAATCTTTGG - Intergenic
941086056 2:161119848-161119870 CAGAAATGGAATAAAATTGCAGG - Intergenic
942646820 2:178120752-178120774 TAGTTCTGGAACAAAATTTTAGG - Intronic
942916480 2:181314670-181314692 CAGACTTGCCAGAAAATTTCTGG + Intergenic
943018017 2:182537874-182537896 TACACCTAGAACAAAATTCCAGG - Intergenic
944857070 2:203778345-203778367 CTCACCTGGAATAAAATTTTGGG - Intergenic
946012993 2:216581456-216581478 CAGACCTGGAAGACAAACTCAGG - Intergenic
946603019 2:221372450-221372472 CAGACATGAGACAAATTTTCTGG + Intergenic
947366868 2:229405725-229405747 CAGACCTTCAGGAAAATTTCTGG + Intronic
947821025 2:233069917-233069939 CATATATGGAAAAAAATTTCTGG - Intronic
1170888652 20:20361711-20361733 CACACGTGGAACCATATTTCAGG + Intergenic
1172165448 20:32896193-32896215 CAGAACTAGAACCAGATTTCAGG - Intronic
1173894035 20:46536875-46536897 CAGACTTGGAACTCATTTTCAGG + Intergenic
1174221225 20:48957113-48957135 CCTACCTGGAACAAAATGACAGG - Intronic
1176387950 21:6148613-6148635 CAGACCTGGAATTAAACGTCAGG + Intergenic
1176658946 21:9615409-9615431 GAGACCAGGAATAAAATTTAAGG + Intergenic
1177491106 21:21827434-21827456 CAGCACTGTAAAAAAATTTCTGG - Intergenic
1177922121 21:27165069-27165091 CTGACCTGAAACACAATTTCAGG - Intergenic
1178065240 21:28897464-28897486 CAGACTTTGAAAAAAATATCTGG + Intergenic
1179735522 21:43389635-43389657 CAGACCTGGAATTAAACGTCAGG - Intergenic
1182390110 22:29986804-29986826 CAGACATGCACCAAAATTACAGG + Intronic
1183569234 22:38639822-38639844 AAGACCTGGAGCAAAGTTTGTGG + Intronic
949829686 3:8200818-8200840 CAGAGCTGGAAGGAAAGTTCTGG + Intergenic
951466913 3:23010869-23010891 TATACCTGGAGCAAAATTGCTGG - Intergenic
951590293 3:24257127-24257149 TAGAGCTGGAACAAGACTTCAGG - Intronic
952243144 3:31554990-31555012 CAGAACTGGATCATAATTACTGG + Intronic
952871546 3:37905459-37905481 CAGGCCTGGAAAAAAACTCCAGG - Intronic
953284344 3:41592010-41592032 TAGTTCTGGAACAAAAGTTCCGG - Intronic
955974092 3:64464051-64464073 CTGAGCTGGATCAAAATTGCAGG + Intergenic
959595356 3:108123279-108123301 CAGATCCGGAACTAAACTTCAGG - Intergenic
960576148 3:119232064-119232086 CTAACCTGAAACTAAATTTCTGG - Intronic
962989232 3:140563432-140563454 AAGGGCTGGGACAAAATTTCAGG + Intronic
965232895 3:166076139-166076161 CAGGTCTGGAAAAAAATTTGAGG - Intergenic
966293900 3:178395184-178395206 AAGAGCTGTAACAAAATCTCAGG + Intergenic
966615253 3:181906513-181906535 CAGACCTGCAACTCTATTTCTGG - Intergenic
966703259 3:182880302-182880324 CAGTACTGTAACAAAATTCCAGG - Intronic
966786204 3:183625040-183625062 CAGAACTGGAACGTGATTTCTGG + Intergenic
967975681 3:195033527-195033549 CAGAGCTGGAAAAATATATCTGG + Intergenic
969356129 4:6627227-6627249 CATACCTAGAACAGAATTGCTGG - Intergenic
970617689 4:17782689-17782711 CTGACTTGGTACAAATTTTCTGG - Intergenic
973548105 4:52002521-52002543 CAGACCTGGAACAGGGCTTCAGG + Intronic
975353692 4:73374544-73374566 CTGACAGGGAAGAAAATTTCTGG - Intergenic
975419128 4:74141601-74141623 CTGACTTGACACAAAATTTCTGG + Intronic
976703889 4:88001925-88001947 AACAACTGGAAAAAAATTTCTGG + Intergenic
977468386 4:97410976-97410998 CAGTCTTTGAAGAAAATTTCAGG + Intronic
977664598 4:99631390-99631412 CAGTCATGGAGTAAAATTTCAGG + Intergenic
979052126 4:115948617-115948639 CAGACTTGGAAAATAATTTATGG - Intergenic
980149735 4:129031003-129031025 CAGACAGAAAACAAAATTTCAGG + Intronic
981075163 4:140583773-140583795 CAGACTTTGAACAAAATTTAAGG + Intergenic
982920254 4:161266035-161266057 GAGACCTGTATCAAATTTTCAGG - Intergenic
984598073 4:181694242-181694264 CAGACCTGGAGCCAAATCTCAGG - Intergenic
985416381 4:189740024-189740046 GAGACCAGGAATAAAATTTAAGG - Intergenic
986787116 5:11124764-11124786 AAAACTTGGAACAAAATATCAGG - Intronic
986790595 5:11155693-11155715 CAGGCCTCCAACAAAATTTAAGG + Intronic
986816356 5:11416115-11416137 CAGAGTTGGAAGAAAATGTCCGG + Intronic
987962332 5:24826395-24826417 CAGACGTGAAATAAAATTGCTGG - Intergenic
990063704 5:51685081-51685103 CAAACATGGAAGAAAATTTATGG + Intergenic
990147062 5:52774164-52774186 CACAACTGAAACAAAATTCCGGG + Intergenic
991005799 5:61826958-61826980 CAGACCAGAAACCAAGTTTCTGG + Intergenic
991655014 5:68895306-68895328 CAGAGCTGGGACTAAAATTCAGG + Intergenic
991726465 5:69540647-69540669 CAGACCTTCAAAAAAAATTCTGG - Intronic
991776801 5:70093197-70093219 TAAAACTGGAAAAAAATTTCTGG - Intergenic
991856088 5:70968642-70968664 TAAAACTGGAAAAAAATTTCTGG - Exonic
991868492 5:71087227-71087249 CAGACCTTCAAAAAAAATTCTGG + Intergenic
991870102 5:71101415-71101437 TAAAACTGGAAAAAAATTTCTGG - Intergenic
995305102 5:110636855-110636877 CAGAACTGGTACAAATTATCTGG + Intronic
997811789 5:136977864-136977886 CAGACCTGGAACAAAATTTCTGG - Exonic
998056258 5:139080577-139080599 TAGACCCTGAACAAAATTTGAGG - Intronic
998857746 5:146410133-146410155 CAGAAGAGTAACAAAATTTCAGG + Intergenic
999850470 5:155532503-155532525 CAGACCTGTGACATAATTCCAGG + Intergenic
999882678 5:155883937-155883959 CAGAACTGGGACTAAATTTCAGG + Intronic
1000810984 5:165861066-165861088 CATACATGTAACAAAAATTCAGG + Intergenic
1001166198 5:169370830-169370852 AAGACCTGAAACAAAAATTCCGG + Intergenic
1001173281 5:169441931-169441953 CAGACTTGCACCTAAATTTCTGG + Intergenic
1003008959 6:2408788-2408810 CAGACTTGGAAATAAATGTCTGG + Intergenic
1004523196 6:16381528-16381550 CAGCCCTGGAAAAATATTACAGG + Intronic
1005144169 6:22668522-22668544 CAGGCATGGAACAAAAATCCGGG - Intergenic
1006259435 6:32855249-32855271 TAGACCTGGGACTAAAATTCAGG - Intronic
1006365501 6:33612818-33612840 AAGTCCTGGAGCAAAATTACTGG - Intergenic
1007026861 6:38584957-38584979 CAGAACTGGAACCAAAGTGCTGG - Intronic
1008808539 6:55462942-55462964 CAGAACTGGAACAATATGTAGGG + Intronic
1012459712 6:99447146-99447168 TAGATCTGGAAGAAAATTACGGG + Intronic
1012526415 6:100183235-100183257 CAGATCTGGTACAAAATTGGAGG - Intergenic
1012556472 6:100519245-100519267 GAGAAATGGATCAAAATTTCTGG + Intronic
1012943024 6:105436484-105436506 CTAACCTGGAATAAAATTTCTGG + Intergenic
1013902454 6:115174508-115174530 GAGAGCTGGAAAAAAATTACAGG + Intergenic
1015827272 6:137327775-137327797 CAGTAATGGAACAAAATTCCTGG - Intergenic
1018606438 6:165602471-165602493 CTGAGCGGGAACAACATTTCTGG + Intronic
1020560473 7:9725296-9725318 CAAACCTGGAACAAAATTTTAGG - Intergenic
1022284955 7:28948047-28948069 AAGAGCTGCAAGAAAATTTCAGG - Intergenic
1022616350 7:31934742-31934764 CTGACCTTGAGTAAAATTTCTGG - Intronic
1022750754 7:33222541-33222563 GAGACCTGGAACAAGATATGAGG - Intronic
1022954273 7:35366948-35366970 CAGCCCTGGGACAACATCTCTGG + Intergenic
1024187592 7:46968660-46968682 CACACCTGGAACTAATTTTGAGG - Intergenic
1027741768 7:82016957-82016979 AACACTTGGAATAAAATTTCAGG - Intronic
1030782967 7:113624556-113624578 GAGACCTGTATCAAATTTTCAGG - Intergenic
1031058099 7:117016240-117016262 GAGCCCTGGAACAAAAATTCTGG - Intronic
1033374920 7:140750300-140750322 AAGACCTGGGACAAGATTCCTGG + Intronic
1034932143 7:155171149-155171171 CAGAACACGAACAGAATTTCAGG - Intergenic
1035985869 8:4431185-4431207 CAGACCTGGAATAAACTCTAGGG - Intronic
1036043161 8:5109109-5109131 CAGAACTGGAAATAAATTTCGGG - Intergenic
1037925794 8:22843293-22843315 CAGACCAGCAACATAATTTGTGG - Intronic
1038912324 8:31979706-31979728 AAGACCTGGAACAGAAATACAGG - Intronic
1039492730 8:37959999-37960021 CAGACCAGGAGCAAAATATCGGG + Intergenic
1039916194 8:41862057-41862079 TGGAACTGGAACAAAATTTCGGG + Intronic
1040038165 8:42891158-42891180 CAGAATTGGAACTAAAATTCAGG - Intronic
1040682814 8:49834255-49834277 CAGACTTTCAACAAAATTCCAGG + Intergenic
1041161228 8:55046112-55046134 CAGACCTGGAAGAAATTCCCAGG + Intergenic
1041316098 8:56564273-56564295 CAAACCTGGAAAAAAATCACTGG - Intergenic
1041756397 8:61317546-61317568 TAGAGATGGAACAACATTTCTGG - Intronic
1042378123 8:68079513-68079535 CAGACCTGGAAGTTAAATTCAGG + Intronic
1045413473 8:101943515-101943537 CAGACCCTGAACACAATATCTGG + Intronic
1048519570 8:135141111-135141133 CAAACATGAAACAAAATTTATGG - Intergenic
1048779131 8:137982047-137982069 CAGATCTGGAAGGAAATCTCAGG + Intergenic
1051153883 9:14118318-14118340 CCTACCTGGAACAAAATGTCTGG + Intronic
1051969482 9:22870315-22870337 CAGACATGGGACAAGTTTTCAGG - Intergenic
1054779458 9:69153283-69153305 CAGACAAGGAAAACAATTTCTGG - Intronic
1054993205 9:71354106-71354128 CAAAACATGAACAAAATTTCAGG - Intronic
1055038279 9:71841499-71841521 CAGATCTGAAAAAAAATTTTTGG - Intergenic
1055667589 9:78567965-78567987 CATACCTGCTACAAAATATCTGG - Intergenic
1055787670 9:79887662-79887684 CAGCCCTGAAACCAATTTTCAGG - Intergenic
1056800640 9:89688420-89688442 CAGGCCAGGAACAATATTCCCGG - Intergenic
1059308742 9:113374205-113374227 CAGCCCTGGAACAAGGCTTCAGG - Exonic
1059930841 9:119258899-119258921 CAGATCTGGGACAGAAATTCAGG + Intronic
1060302997 9:122386782-122386804 CAGACCTGGGTCCAAATTCCAGG + Intronic
1061066820 9:128283555-128283577 CAGACCTGGAGCAGATTCTCTGG + Intronic
1203636692 Un_KI270750v1:119017-119039 GAGACCAGGAATAAAATTTAAGG + Intergenic
1186178379 X:6948917-6948939 CAGAACTGGAATATAATTTAAGG + Intergenic
1188348148 X:29093847-29093869 CAGGCCTGGAGCCAAAGTTCAGG - Intronic
1188868933 X:35349937-35349959 CACACCTTGAACTAAGTTTCAGG - Intergenic
1192069696 X:67923766-67923788 CAGACCTGGAAGGAACTTGCAGG + Intergenic
1192843272 X:74879564-74879586 AACACCTGGAAGCAAATTTCAGG + Intronic
1194212261 X:91083002-91083024 CAGACATGGGACAAAACCTCAGG + Intergenic
1195111301 X:101652907-101652929 CAGTCCTGGAAAAGTATTTCTGG - Intergenic
1195251728 X:103054306-103054328 GAGAACTGGTACAACATTTCTGG - Intergenic
1195925816 X:110023475-110023497 CAAACTTGGATCTAAATTTCTGG - Intronic
1195974966 X:110516779-110516801 CAGAGCTGGAACACAAAGTCAGG - Intergenic
1196977461 X:121175813-121175835 CAGACCTGTAAGATAATTTTGGG + Intergenic
1199677089 X:150198054-150198076 CAGACCTGGCAGAGGATTTCAGG - Intergenic
1199804837 X:151288312-151288334 CAAAGCTGAAACAAAAATTCAGG + Intergenic
1201609013 Y:15819807-15819829 CACACAAGAAACAAAATTTCAGG + Intergenic