ID: 997811869

View in Genome Browser
Species Human (GRCh38)
Location 5:136978637-136978659
Sequence TGGTAGTGCCCACAAGAAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997811869 Original CRISPR TGGTAGTGCCCACAAGAAAG AGG (reversed) Exonic