ID: 997813033

View in Genome Browser
Species Human (GRCh38)
Location 5:136990597-136990619
Sequence CATGACATTCGATCAAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997813033_997813037 14 Left 997813033 5:136990597-136990619 CCCTTCTTTGATCGAATGTCATG 0: 1
1: 0
2: 1
3: 2
4: 99
Right 997813037 5:136990634-136990656 TTGATGATGCTGTCCCTCAGGGG 0: 1
1: 0
2: 0
3: 19
4: 177
997813033_997813035 12 Left 997813033 5:136990597-136990619 CCCTTCTTTGATCGAATGTCATG 0: 1
1: 0
2: 1
3: 2
4: 99
Right 997813035 5:136990632-136990654 CTTTGATGATGCTGTCCCTCAGG 0: 1
1: 0
2: 2
3: 16
4: 225
997813033_997813036 13 Left 997813033 5:136990597-136990619 CCCTTCTTTGATCGAATGTCATG 0: 1
1: 0
2: 1
3: 2
4: 99
Right 997813036 5:136990633-136990655 TTTGATGATGCTGTCCCTCAGGG 0: 1
1: 0
2: 1
3: 16
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997813033 Original CRISPR CATGACATTCGATCAAAGAA GGG (reversed) Intronic
913390177 1:118301974-118301996 CATACCATTCTATCAAAGAACGG + Intergenic
918547540 1:185701547-185701569 CATGACACTCCATCAAAAGAAGG + Intergenic
1065116225 10:22485719-22485741 CATGACATTCTCTCAACTAATGG - Intergenic
1069431094 10:68334799-68334821 CATGACATTGTTGCAAAGAAAGG + Intronic
1070747599 10:78944059-78944081 CAAGACAGTTGATCCAAGAAAGG + Intergenic
1072435170 10:95408008-95408030 CATGTCATCCTATGAAAGAAAGG - Intronic
1078297370 11:10086973-10086995 CAGGACTTTAGATCAAAGATGGG - Intronic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1092920537 12:13227779-13227801 CATTACATTAGACCAATGAAAGG + Intergenic
1097515470 12:60599341-60599363 CATGACAGACGATCACAGACTGG - Intergenic
1098052679 12:66471014-66471036 CATGGCAGTCGATCAGAGGAAGG - Intronic
1098529969 12:71530704-71530726 TAAGCCATTCCATCAAAGAATGG + Intronic
1098623192 12:72630617-72630639 CCTGATATTCCATCAAACAAAGG - Intronic
1099338497 12:81396391-81396413 TATGACATTTGAACAAAGACTGG + Intronic
1104215556 12:126729405-126729427 CATGACATAGGGACAAAGAAAGG - Intergenic
1106935456 13:34713815-34713837 CATGACATTTGATGTACGAACGG - Intergenic
1108672282 13:52703771-52703793 CATGACATTCGACCCTAGACTGG - Exonic
1109149560 13:58828773-58828795 CATGACATTAGCACAAAGCAAGG + Intergenic
1110946147 13:81420888-81420910 CAGGACATTCTAGCCAAGAATGG - Intergenic
1111730403 13:92068944-92068966 CATGACCTTAGATTAAACAATGG - Intronic
1113050561 13:106206843-106206865 CATGACATTCGCTCACACAGAGG - Intergenic
1113682723 13:112255608-112255630 CATGTTAGTAGATCAAAGAACGG + Intergenic
1120011984 14:79426403-79426425 TTTGACATTCAATCAGAGAAAGG + Intronic
1123669012 15:22635610-22635632 CATGACCTTAGATTAAACAATGG - Intergenic
1123677556 15:22726031-22726053 CATGTCATTTGATAAAAGGATGG + Intergenic
1124329762 15:28800294-28800316 CATGTCATTTGATAAAAGGATGG + Intergenic
1124457940 15:29861909-29861931 CATGACCTTGGATTAAGGAATGG - Intronic
1126303949 15:47233007-47233029 TATGACATTAGATCAAGCAATGG - Intronic
1127200844 15:56648261-56648283 TATAACATTTGAGCAAAGAATGG - Intronic
1129027420 15:72590538-72590560 CATGTCATCAGATCAAAGTAAGG - Exonic
1129824243 15:78624370-78624392 GGTGACATTGGAGCAAAGAATGG + Exonic
1132199165 15:99936748-99936770 CATGACCTTGGATTAAATAATGG - Intergenic
1135106428 16:19653766-19653788 CATGGCAGTGGTTCAAAGAATGG - Intronic
1141060318 16:80861013-80861035 CAGGACATTCAATTGAAGAATGG + Intergenic
1151216561 17:72581101-72581123 CCTGAGATTTCATCAAAGAAAGG - Intergenic
1154037880 18:10823807-10823829 CATTACATTCAATTAAAAAATGG - Intronic
1161773556 19:6244303-6244325 CATGAAACTCCAGCAAAGAATGG + Intronic
1168196502 19:54778339-54778361 CATGACATTGGCATAAAGAAAGG - Intronic
1168202275 19:54824755-54824777 CATGACATTGGCATAAAGAAAGG - Intronic
1168207081 19:54858806-54858828 CATGACATTGGCATAAAGAAAGG - Intronic
925680051 2:6411133-6411155 GATGAAAATCAATCAAAGAAGGG + Intergenic
925774086 2:7316196-7316218 CATGACATTCTGGAAAAGAAAGG + Intergenic
928380594 2:30814407-30814429 CAGGAGATGCAATCAAAGAAGGG - Intronic
931980720 2:67691370-67691392 AATGACATTTGAAGAAAGAAAGG + Intergenic
934584468 2:95478483-95478505 CATGAAATTGTATCAGAGAATGG + Intergenic
934594984 2:95598232-95598254 CATGAAATTGTATCAGAGAATGG - Intronic
934787782 2:97027290-97027312 CATGAAATTGTATCAGAGAATGG + Intergenic
943853427 2:192757242-192757264 AATGACATACAATCATAGAAGGG - Intergenic
1169492103 20:6080056-6080078 GGTGACATTTGATCAAAAAATGG + Intronic
1170188073 20:13615045-13615067 CATGTCATTTGATAAAAGGATGG - Intronic
1175572908 20:60037502-60037524 AATGACATTGGAACCAAGAAAGG - Intergenic
1176229559 20:64025182-64025204 CATGGTATTTGCTCAAAGAAGGG - Intronic
1177568349 21:22853159-22853181 GCTGACATTTGATCAAAGACTGG + Intergenic
951054218 3:18128682-18128704 CATGACATTCACTGAAAAAAGGG - Intronic
956219952 3:66892232-66892254 CATGACATTCGATCAGGCTATGG - Intergenic
956818696 3:72932460-72932482 CATGACTTTGGATTAAACAATGG - Intronic
956980067 3:74626077-74626099 CATTAACTTCGAGCAAAGAATGG + Intergenic
959224940 3:103568363-103568385 AATGGCATTCCATCAAAGATAGG - Intergenic
963432299 3:145223862-145223884 CATTATATTCCATCAAATAAAGG - Intergenic
965073563 3:163947301-163947323 GATGTCATTCGATCGACGAATGG + Intergenic
971268734 4:25117460-25117482 CATGACTTTGGCTCAAAGACAGG + Intergenic
971528463 4:27653344-27653366 CATGACATTTGAACATGGAAGGG + Intergenic
972108363 4:35523391-35523413 CATGATATGAGAGCAAAGAAAGG + Intergenic
973115246 4:46449495-46449517 CTTGATATTCGTTAAAAGAATGG + Intronic
977380299 4:96264332-96264354 CAAGTCATTCCATCAAGGAAGGG - Intergenic
977992552 4:103461916-103461938 GATGACTTGCCATCAAAGAAAGG + Intergenic
978362806 4:107948803-107948825 CATGACATTGGATCACTTAACGG + Intronic
981565235 4:146094180-146094202 CATGACATTCATTCAAAGAAAGG + Intergenic
984462369 4:180054684-180054706 CAGGACATTGGAACAAAGACAGG - Intergenic
988567503 5:32330962-32330984 CATGTCATTCAATCAAACAAAGG + Intergenic
990007077 5:50956050-50956072 TATGACATGCCATCAAAGACTGG + Intergenic
990719284 5:58675716-58675738 CATTACATTGGATCATGGAAGGG + Intronic
993475702 5:88361642-88361664 AATGACATTTGAGCACAGAAGGG - Intergenic
997813033 5:136990597-136990619 CATGACATTCGATCAAAGAAGGG - Intronic
1000829672 5:166087197-166087219 CATGACATTCAGGCTAAGAAAGG + Intergenic
1007474448 6:42109484-42109506 GGTGACATTTGAGCAAAGAAGGG + Intronic
1010682550 6:78813507-78813529 CATGACATTCGATCATTAACAGG + Intergenic
1019900927 7:4020141-4020163 CATGTCCCTCGAACAAAGAAGGG - Intronic
1023699848 7:42882298-42882320 CATGACATTGCAGTAAAGAAAGG - Intergenic
1028060228 7:86304065-86304087 CATGACATTTCATGAAAAAATGG + Intergenic
1029897535 7:104000189-104000211 CCTGACATTAGATCAAAGGGAGG + Intergenic
1031222387 7:118985556-118985578 CATGAGATTGGATGAAATAAGGG - Intergenic
1032791281 7:135244692-135244714 CATGTCATTAGAACCAAGAAGGG - Intronic
1035117496 7:156536908-156536930 CATGACATTTTAAAAAAGAAAGG - Intergenic
1035117774 7:156539069-156539091 CATGACATTTTAAAAAAGAAAGG - Intergenic
1037389881 8:18382169-18382191 CATGACATTAGCTCAATGCATGG - Intergenic
1037435678 8:18860911-18860933 GATGAGCTTTGATCAAAGAATGG - Intronic
1040016696 8:42706126-42706148 AATGACATTTGAGCAAAGACTGG + Intronic
1041631118 8:60088242-60088264 CATACCATTCCATCAAAAAATGG - Intergenic
1042105251 8:65319457-65319479 AATGACTTTCTATCACAGAAAGG - Intergenic
1043553401 8:81401207-81401229 CATGAAATTTGACCATAGAAAGG - Intergenic
1045416938 8:101976792-101976814 CATTACAGTCTAGCAAAGAAGGG + Intronic
1045568268 8:103343437-103343459 CAACACATTGGATCAATGAAGGG + Intergenic
1051417435 9:16856917-16856939 CAATACATTTGCTCAAAGAAAGG - Intronic
1054994364 9:71368163-71368185 CATCACATTTTAGCAAAGAAAGG - Intronic
1058611281 9:106778733-106778755 GATGACAATGGATCACAGAAGGG + Intergenic
1061316221 9:129797566-129797588 CATGACATTTGATGAGAGAGTGG - Intergenic
1188310595 X:28612283-28612305 CTTGACCTTCTTTCAAAGAAAGG + Intronic
1193149687 X:78112051-78112073 GATGACATCTGAGCAAAGAATGG - Intronic
1195345981 X:103951742-103951764 CATGACATCTGAGCTAAGAAAGG + Intronic
1196902009 X:120393273-120393295 CATGCCCTTCGATTAAACAATGG + Intergenic
1197028738 X:121788074-121788096 CATGATGGTAGATCAAAGAAGGG + Intergenic
1200605237 Y:5255387-5255409 AATGATATTCAATCATAGAAAGG - Intronic