ID: 997815927

View in Genome Browser
Species Human (GRCh38)
Location 5:137017020-137017042
Sequence TGGGGGCCACAGCATGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 266}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997815927_997815937 26 Left 997815927 5:137017020-137017042 CCTGCAGCATGCTGTGGCCCCCA 0: 1
1: 0
2: 3
3: 21
4: 266
Right 997815937 5:137017069-137017091 TGGCCTCACACGACCTGCTGAGG 0: 1
1: 0
2: 0
3: 12
4: 118
997815927_997815932 6 Left 997815927 5:137017020-137017042 CCTGCAGCATGCTGTGGCCCCCA 0: 1
1: 0
2: 3
3: 21
4: 266
Right 997815932 5:137017049-137017071 TCCTCCCCTGTTCTTCTAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 170
997815927_997815939 30 Left 997815927 5:137017020-137017042 CCTGCAGCATGCTGTGGCCCCCA 0: 1
1: 0
2: 3
3: 21
4: 266
Right 997815939 5:137017073-137017095 CTCACACGACCTGCTGAGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997815927 Original CRISPR TGGGGGCCACAGCATGCTGC AGG (reversed) Intronic
900243287 1:1626801-1626823 AGGGGGTCACAGCAGGCTGCAGG - Intronic
900391268 1:2435007-2435029 TGCGAGCCTCAGCATGCAGCAGG + Intronic
900548760 1:3243184-3243206 TGTGGCCCACAGCCCGCTGCTGG + Intronic
900592362 1:3465719-3465741 TGGGGGCCCCAGCAGGAGGCCGG - Intronic
900625020 1:3604049-3604071 TGGGTGCCACAGCAGCCTGGTGG - Intronic
904608372 1:31711353-31711375 TGGGGGCCACACCAGTCTGGGGG - Intergenic
904697060 1:32336536-32336558 TGGGGGCCGCTCCAGGCTGCGGG - Intergenic
907265564 1:53258224-53258246 TCTGGGACACAGTATGCTGCTGG - Intronic
907328933 1:53658905-53658927 TGGGGGGCACAGCAGGCAGGAGG + Intronic
907701459 1:56792203-56792225 TGGGGGCCACCACGTGCTTCTGG + Exonic
913314100 1:117535420-117535442 TGGAGGCCCCAGCAGGCTGCTGG - Intergenic
915111294 1:153566017-153566039 TGGGGGCCAGAGGAGGCAGCTGG + Intronic
918308426 1:183267909-183267931 TGAGGGCCACTGTATGCTGCAGG - Intronic
920201620 1:204263121-204263143 TGGGGGACAAAACATGCCGCGGG + Intronic
920372792 1:205490116-205490138 GAGGGGCCACAGCACACTGCTGG + Intergenic
922062288 1:222104177-222104199 TTGGGGTCCCAGCATCCTGCAGG + Intergenic
922707466 1:227796879-227796901 TGGGGGCAGCTGCATGCTGGAGG - Intergenic
923064370 1:230504477-230504499 TTGTGTCCTCAGCATGCTGCTGG + Intergenic
923420580 1:233810828-233810850 TGTGTGACACAGCATGCTGAAGG - Intergenic
923694296 1:236231996-236232018 TGGAGGAAACAGCATGCAGCTGG - Intronic
1063901091 10:10733143-10733165 TGGGGGCCGAAGCTAGCTGCAGG - Intergenic
1067089309 10:43258534-43258556 TGCAGGCCACAGCAGGCGGCTGG + Intronic
1067346160 10:45440603-45440625 TGGGGTGCACAGCAGGCAGCTGG - Exonic
1067348884 10:45457862-45457884 TGGGGACCACTGCAAGCTGGAGG + Exonic
1067428050 10:46224120-46224142 TGGGCGCCACACCATCCTGCTGG + Intergenic
1068313147 10:55305463-55305485 TGGGGGCCTCAGCTGGCTACAGG - Intronic
1069515357 10:69072847-69072869 AGGGGGCTATGGCATGCTGCAGG + Intergenic
1069817410 10:71207133-71207155 AGGTGGCCACTGCATGCTCCTGG - Intergenic
1069902185 10:71712792-71712814 TGAAGGCCACAGCATCTTGCAGG + Exonic
1070151218 10:73806432-73806454 GGGGGGCCACAGCATACCCCAGG + Exonic
1071297413 10:84232379-84232401 TGGGCAGCACAGCATGCGGCGGG - Exonic
1072321134 10:94251264-94251286 TGGGATCCACAGCAGGATGCAGG + Intronic
1072757362 10:98030171-98030193 TGGGGGCGACAGCCAGCAGCTGG - Intronic
1072784597 10:98270969-98270991 TGGAGGCCACCGCTTTCTGCAGG - Intergenic
1075002897 10:118810927-118810949 TGGGGGCCCCAGCATCCTGCTGG + Intergenic
1075269736 10:121038249-121038271 TGGGGGCCAGGGCACGATGCTGG + Intergenic
1076120111 10:127929612-127929634 TGGGAGCCACAGGCTGCAGCGGG + Intronic
1076725901 10:132412978-132413000 TGGTGACCACAGCAGCCTGCTGG + Intronic
1077231311 11:1459292-1459314 TGGCGGCCACAGCGGGCTGAGGG - Intronic
1077445255 11:2587750-2587772 TGGGGGCCGCAGCACGAGGCTGG + Intronic
1077517014 11:3008145-3008167 TGGGGGTCCCAGCAGGCTGGGGG - Intronic
1077530549 11:3092825-3092847 TGGGGGCCACAGGGTGGGGCTGG - Intronic
1077556564 11:3228805-3228827 GGGGGGCCAGGGGATGCTGCAGG + Exonic
1078577936 11:12517322-12517344 TGGGGACCAGAGCATGGTGGGGG - Intronic
1080648560 11:34204741-34204763 AGTGGGCCCCAGCCTGCTGCAGG + Intronic
1080778253 11:35406474-35406496 TGAGGACCAAAGCATGCTCCAGG + Intronic
1081283821 11:41244817-41244839 TTGGGGCTATAGCATACTGCAGG + Intronic
1083411046 11:62492585-62492607 TGTGAGCCACTGCATCCTGCTGG - Intronic
1083616956 11:64031042-64031064 TGGGGGCAGGAGCATGCTGAAGG + Intronic
1083757760 11:64800740-64800762 TAAGGGCCACACCCTGCTGCCGG - Intronic
1084312826 11:68326657-68326679 GGGGAGCCACAGCAGGCTGCAGG - Intronic
1084380209 11:68807053-68807075 TGAGGGCCAAAGCAAGCTGGAGG + Intronic
1084794471 11:71495993-71496015 TGGAGGCCACAGGGTGCCGCTGG - Intronic
1087006736 11:93478985-93479007 TGGGGTCCGCAGCCGGCTGCGGG + Exonic
1089292272 11:117444463-117444485 CGGGAGCCAGAGCAGGCTGCAGG - Intronic
1090173188 11:124623046-124623068 CGGGGGCCCCAGGACGCTGCCGG - Exonic
1091722557 12:2823979-2824001 GGAGACCCACAGCATGCTGCAGG + Intronic
1092057282 12:5518651-5518673 TGGGAACCACAGTGTGCTGCGGG - Intronic
1092135033 12:6141123-6141145 TGGGGGCTACAGCTTTATGCTGG - Intergenic
1093147602 12:15585444-15585466 GGGGAGGCACTGCATGCTGCTGG + Intronic
1094605398 12:31944859-31944881 TGGAGGCAACAGCATGTTTCTGG - Intergenic
1099330198 12:81275210-81275232 TGGGGGCCCCAGGAAACTGCAGG - Intronic
1100913408 12:99390789-99390811 AGGGGGCCTCAGCAGGCAGCTGG + Intronic
1101039812 12:100744055-100744077 TGGGGGCATCAGTATGCAGCTGG - Intronic
1103663112 12:122537850-122537872 TGTGAGCCACTGCATGCAGCTGG - Intronic
1103804941 12:123565100-123565122 TGGGGCCCCCAGCATGCTCTGGG - Intergenic
1103994562 12:124820668-124820690 TGGGGGACACATCCAGCTGCTGG + Intronic
1104069566 12:125332478-125332500 TGGAGGGCACAGCCTGCTTCTGG - Intronic
1104506440 12:129336773-129336795 TGTGGGAAACAGCATGCAGCCGG + Intronic
1104872545 12:132010364-132010386 TGTGAGCCACTGCATGCAGCCGG + Intronic
1104892624 12:132147804-132147826 GGGAGGCAACAGCATGATGCTGG - Intronic
1105015069 12:132781696-132781718 TGGGGGCCAAATCGAGCTGCTGG - Intronic
1105787827 13:23767185-23767207 TGGGGGTCACACAAGGCTGCAGG - Intronic
1106473984 13:30081569-30081591 TGGGATCCACAGCATGCATCTGG + Intergenic
1107951093 13:45462911-45462933 TGGGGAACACAGCATGCTGCTGG + Intergenic
1113253488 13:108480714-108480736 TTGGAGCCACAGGATGCTTCTGG + Intergenic
1113774333 13:112934230-112934252 TGAGGGCCCCAGCAGCCTGCAGG + Intronic
1114610662 14:24037910-24037932 TGGTGGCCACAGTGAGCTGCAGG + Intergenic
1117540699 14:56744023-56744045 TGGGGCCCACTGCATGCTCTTGG + Intergenic
1117955757 14:61122598-61122620 TGGGACCCATAGCATGCTCCAGG + Intergenic
1119857739 14:77913397-77913419 TGAGGGCCCCTGCAGGCTGCTGG - Intronic
1121312269 14:92941587-92941609 GGGAGGCCACACAATGCTGCTGG + Exonic
1122075280 14:99231519-99231541 TGGGGGCCACCGCTGGCAGCTGG + Exonic
1122549259 14:102540959-102540981 CGGGGGCCAGGGCATGCTTCCGG - Intergenic
1122803458 14:104244770-104244792 CCAGGGCCACAGCATGCTTCTGG - Intergenic
1122891164 14:104732913-104732935 TGGGGGTCACAGCACCCTCCTGG - Intronic
1123018550 14:105386915-105386937 GGGCGGCCAGAACATGCTGCAGG - Intronic
1124138819 15:27059274-27059296 TTGGGGCCACAGCCAGCTACAGG + Intronic
1124552696 15:30696296-30696318 TGGTGTCCAGAGAATGCTGCTGG + Intronic
1124678546 15:31709374-31709396 TGGTGTCCAGAGAATGCTGCTGG - Intronic
1127774311 15:62253523-62253545 TGGCAGCCACAGCAGGCTGGAGG + Intergenic
1128074883 15:64819877-64819899 TGAGGGCCACATCATCCTGGTGG + Exonic
1129379954 15:75158551-75158573 TGAGGGCCGCGGCTTGCTGCTGG + Intergenic
1132710269 16:1263243-1263265 TGGAGGCCACAGGTGGCTGCCGG + Intergenic
1132805626 16:1773792-1773814 TCGGGTCCACCGCAGGCTGCGGG - Exonic
1133113897 16:3565081-3565103 TGGGGGGCACGGCAGGCAGCAGG - Exonic
1133131738 16:3680392-3680414 TGGGGGCCACATCTTGATGGTGG - Intronic
1136187440 16:28596507-28596529 TGGGGGCCAGAGCCTGATGTGGG + Intronic
1136319047 16:29470723-29470745 TGGGGGCCAGAGCCTGGTGTGGG - Intergenic
1136433618 16:30210067-30210089 TGGGGGCCAGAGCCTGGTGTGGG - Intergenic
1137033590 16:35547748-35547770 TGGGAGCCACAGCAGCCAGCAGG + Intergenic
1138671258 16:58616536-58616558 TGTGAGCCACAGCATCCAGCTGG + Intronic
1139337143 16:66240748-66240770 TGGGAGCCACAGCAGGTTGGCGG - Intergenic
1142219427 16:88846388-88846410 TGGGGGCCACCAGAAGCTGCAGG + Intronic
1142359559 16:89619738-89619760 CAGGGGGCACAGCAGGCTGCAGG - Intronic
1142359579 16:89619792-89619814 TGGGGGGCACAGGGCGCTGCAGG - Intronic
1143363029 17:6386960-6386982 TGGGGGCCAGGCCATGCTTCGGG - Intergenic
1143781393 17:9231397-9231419 TGGGGGCCACAGCAGGGTGGGGG - Intronic
1144202060 17:12950483-12950505 TGGGAGCCAGAGCATGCATCAGG - Intronic
1146369300 17:32255105-32255127 TGGGGGCAACAGCATGATTCAGG + Intergenic
1146705199 17:34996102-34996124 TGGGGGCCACAGCATGATCTTGG + Exonic
1147168266 17:38604703-38604725 TGGGGGCAGCAGGATGCTGGTGG - Intronic
1147186809 17:38717507-38717529 TGGGGGCCCCAGGAGGCTGGAGG - Exonic
1148458925 17:47826706-47826728 TGTGGGGCACAACATGCTGCTGG - Exonic
1149477808 17:56977996-56978018 TGCGGGTCTCAGCAAGCTGCCGG + Intergenic
1150454762 17:65298385-65298407 TGGGGGCCACAGCATGTCATGGG - Intergenic
1151177376 17:72299918-72299940 TGGGGGCCACAGATCTCTGCAGG - Intergenic
1152252440 17:79219039-79219061 TGGGGCCCACACCAAGCAGCTGG - Intronic
1152556438 17:81055408-81055430 TGGGGGCCCCTGCAGGGTGCCGG - Intronic
1152708022 17:81855381-81855403 AGGGGTCCACAGCCTGCAGCTGG - Intronic
1152919500 17:83058914-83058936 CGGGGCTCACAGCAGGCTGCCGG + Intergenic
1154354882 18:13616996-13617018 TCAGGGCAACAGCATGGTGCAGG + Intronic
1156489356 18:37487143-37487165 TGCCGGCCACAGAATGCTCCCGG + Intronic
1157813135 18:50711906-50711928 TGGGGCCCACAACATGGTACTGG - Intronic
1158256167 18:55551286-55551308 CAGGAGCCACAGCATGCAGCAGG - Intronic
1158744842 18:60188183-60188205 TGGGAGCCACAGGATGGTGAGGG + Intergenic
1159087393 18:63809417-63809439 TGGGTGCAACAGCATGATCCAGG + Intergenic
1160281271 18:77493282-77493304 TGGAGGCCACTGGAGGCTGCAGG + Intergenic
1160409290 18:78664203-78664225 TGGGGGCCACACCCTGCTATGGG - Intergenic
1160795397 19:942945-942967 TTGGGGCCACCGTACGCTGCAGG - Intronic
1162328413 19:10012034-10012056 TGGGGGCCTCTTCATGCTGGAGG - Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1163302942 19:16459207-16459229 TTGGGGCCGCTGCCTGCTGCAGG + Intronic
1163313039 19:16525423-16525445 TGGGGGCCGCTGCATGCGGAAGG + Exonic
1163691249 19:18739625-18739647 TGGGGAGCACAGCATGGTGGGGG + Intronic
1164834577 19:31349351-31349373 TGGGCGCAGCAGCATCCTGCGGG - Exonic
1165072770 19:33265090-33265112 TGGGGCCCAGAGAATCCTGCTGG - Intergenic
1165540726 19:36490834-36490856 GGGGGGCCAAAGCAGGCGGCTGG - Intergenic
1165723557 19:38096676-38096698 TTGTAGCCACAGCATGCTGCTGG - Intronic
1166729812 19:45052670-45052692 TGGGGACCAAAGCAGGCTGAGGG + Intronic
1166750913 19:45163625-45163647 TGGGGGCGACGGCAGGCTCCAGG - Intronic
1168164449 19:54537177-54537199 TGGGCACCAGAGCATGCAGCAGG - Intronic
925640437 2:5981575-5981597 CGGGGATCACAGGATGCTGCCGG - Intergenic
925924674 2:8661462-8661484 TGCGAGCCACAGCAGGCTGGCGG + Intergenic
926614034 2:14976905-14976927 TGGAGGCCAAATCATGCTGTTGG - Intergenic
926845911 2:17138874-17138896 TATGTGCCACAACATGCTGCTGG - Intergenic
927145669 2:20164164-20164186 AGGAGGCCAGAGCATGCTGAGGG + Intergenic
927149232 2:20186230-20186252 TGGAGATCACAGCATCCTGCCGG - Intergenic
927757953 2:25723795-25723817 GGGGGGCCAAGGCAGGCTGCTGG + Intergenic
930839044 2:55825658-55825680 TGGTGGCTGCAGCATGCTGGAGG - Intergenic
933768132 2:85725025-85725047 TGGGTGGCTCAGCATGCAGCAGG + Intergenic
935878323 2:107536163-107536185 TGTGGGCTCCAGCATGCAGCTGG - Intergenic
936049805 2:109214147-109214169 TAGGGGCCTCAGCAGGCTGTTGG + Intronic
936145906 2:109980542-109980564 TGGGGGCCACTTCATGGTGGGGG - Intergenic
936198784 2:110390936-110390958 TGGGGGCCACTTCATGGTGGGGG + Intergenic
937285146 2:120745997-120746019 TGGGTGCCACATCCTTCTGCAGG + Intronic
937477924 2:122231402-122231424 TCTGGCCCACAGCCTGCTGCTGG + Intergenic
937871539 2:126789575-126789597 TGTGAGTCACAGCATGATGCTGG + Intergenic
944803873 2:203261920-203261942 TGCTGGCCACTCCATGCTGCAGG + Intronic
945257439 2:207814043-207814065 TGGTGGCCAGATCATGCTGCTGG + Intergenic
945354196 2:208818076-208818098 TGGGGAACACAGCATGTTGAGGG - Intronic
945711439 2:213301626-213301648 TCTGAGCTACAGCATGCTGCTGG + Intronic
946147379 2:217741253-217741275 TGGGGGCCACTGGGGGCTGCAGG + Intronic
948403661 2:237702039-237702061 TGGGCTCCACAGCAGGCTGTGGG + Intronic
948831635 2:240601166-240601188 TGGCGGCCACACCCTCCTGCTGG + Intronic
1169054781 20:2611555-2611577 TGGGGGCCACAGAAGACTTCCGG - Intronic
1169108959 20:3019706-3019728 GGGAGGCCAAAGCAGGCTGCTGG + Intronic
1169489325 20:6057728-6057750 TGGGGGCCTCATCTTGCTGGGGG + Intergenic
1171213768 20:23336965-23336987 TGGGGGTCACAGAGTGCTGAGGG - Intergenic
1171376143 20:24695296-24695318 TCTGGGCCACTGCCTGCTGCAGG + Intergenic
1172356758 20:34285589-34285611 TGGGCGCCGCATCATCCTGCTGG - Exonic
1172702366 20:36861580-36861602 TGGAGCTCACAGCATGCTGCTGG - Intronic
1173226676 20:41166230-41166252 TGGGGGTCCCAGCATCTTGCCGG - Exonic
1175861546 20:62152851-62152873 TGGGGGCCACAGCTGCCTGTCGG + Intronic
1176309205 21:5140891-5140913 TGGGTGTGACAGCATGCTGCTGG + Intronic
1176671585 21:9739813-9739835 TGTGAGCCACTGCATCCTGCTGG - Intergenic
1179847856 21:44121142-44121164 TGGGTGTGACAGCATGCTGCTGG - Intronic
1180126379 21:45793067-45793089 TGGGAACCACAGCACGCTGGAGG + Intronic
1180130041 21:45821364-45821386 CGGGGCCCACAGCGTGGTGCAGG - Intronic
1180130057 21:45821423-45821445 CGGGGCCCACAGCACGGTGCAGG - Intronic
1180130084 21:45821543-45821565 CGGGGCCCACAGCAGGGTGCAGG - Intronic
1181962488 22:26632756-26632778 TGGGGACCAGAACATTCTGCTGG + Intergenic
1183074994 22:35421292-35421314 TGGGGGCAACAGCGTGCTCAGGG - Intronic
1183086103 22:35488237-35488259 TGGGGGACACAGGCAGCTGCTGG + Intergenic
1183512610 22:38244925-38244947 TAGGGGCCACAGCCTCCCGCAGG + Intronic
1183987765 22:41578716-41578738 TGGGGGCCACAGCCTGGTCTTGG + Intronic
1184799667 22:46751912-46751934 TTTGGGACACAGCCTGCTGCAGG + Intergenic
1184805509 22:46792779-46792801 TGGGAGCCACAGCCTGATGTGGG + Intronic
1185105524 22:48867446-48867468 TGGGGGCCACATTCTGTTGCTGG - Intergenic
1185121799 22:48975682-48975704 TGGGGGCCACACCTTGCTGGAGG - Intergenic
1185289433 22:50016189-50016211 TGGCTGGCCCAGCATGCTGCTGG - Intronic
1203216119 22_KI270731v1_random:6961-6983 TGGGGAACACAGCATTCTCCAGG + Intergenic
954286822 3:49625244-49625266 TATGGGACACAGCGTGCTGCTGG - Exonic
954448821 3:50560866-50560888 TGGAGGACAGAGGATGCTGCAGG + Intronic
954714413 3:52519987-52520009 TGTGGGCCACAGCATTGTGAAGG - Exonic
961888097 3:130109630-130109652 CGGGAGCCAAAGCTTGCTGCTGG - Intronic
963416414 3:145000905-145000927 TTGGGGCCACAGCTGACTGCAGG - Intergenic
963492547 3:146019148-146019170 TGGTGGCCTCAGCCTGGTGCAGG - Intergenic
964376899 3:156056825-156056847 TGGTCAACACAGCATGCTGCTGG + Intronic
965357524 3:167694673-167694695 TGTGGGCCATGGCATGCTGAGGG + Intronic
965419179 3:168436060-168436082 AGGTGGCCACAGCTTGCTGAGGG + Intergenic
966456092 3:180117925-180117947 TGGCAGCCACACCATGCTGTGGG - Intergenic
967079766 3:186038566-186038588 TGGGGGCCAAGGGAAGCTGCCGG + Intergenic
967136393 3:186516189-186516211 AGGGGACCACTGCATGTTGCAGG - Intergenic
967621770 3:191642491-191642513 TGGTGGCCGTAGCATGCTGGAGG - Intergenic
967992001 3:195138468-195138490 TGAGGGCCACAGCTGGGTGCAGG + Intronic
968613975 4:1569108-1569130 TGTGGGCCGCAGCACGCAGCCGG + Intergenic
968889713 4:3362032-3362054 TCGGGGCCGCAGCCTGCTGTGGG - Intronic
968999754 4:3970634-3970656 TTGGGGCCCCAGCAGGCTGGAGG - Intergenic
969530880 4:7729518-7729540 TGGGGGCCCCAGTATGAGGCAGG + Intronic
969754253 4:9138001-9138023 TGGGGGCCCCAGCAGACTGGAGG + Intergenic
969814148 4:9674277-9674299 TGGGGGCCCCAGCAGACTGGAGG + Intergenic
970436352 4:16039454-16039476 TGTGAGCCACGGCATCCTGCCGG - Intronic
970614916 4:17760028-17760050 TAGGGGACACAGCATGATGCAGG - Intronic
972684069 4:41334901-41334923 TGGTGGCCACAGCATGAAGATGG + Intergenic
976815262 4:89140288-89140310 TGGGGCCCGCAGGATGCTGGGGG + Intergenic
977666177 4:99649677-99649699 TGGGAGCCACAGCCTGCTGCTGG + Exonic
983634988 4:169888503-169888525 TGTGGGCCACAGGATTCTGCAGG - Intergenic
984290841 4:177792067-177792089 TGGTGGCCTCACCATGATGCAGG - Intronic
985040688 4:185888736-185888758 GGGTGGACACAGCAGGCTGCTGG - Intronic
985926379 5:3022848-3022870 TGTGGGCCACAGCAGGAGGCCGG + Intergenic
986286905 5:6365808-6365830 TGTGAGTCACAGGATGCTGCTGG + Intergenic
987187780 5:15443284-15443306 TGGGGTCCACATCATGATGGTGG + Intergenic
992557292 5:77916163-77916185 TGGGGCCCACAGATTGCTGGTGG - Intergenic
995109152 5:108409066-108409088 TGGGGGTCTCAGTATGTTGCAGG - Intergenic
995134037 5:108660984-108661006 AGGGGGTCTGAGCATGCTGCAGG + Intergenic
995252306 5:110007336-110007358 TAGGGCCCACAGAATGCAGCTGG + Intergenic
996121723 5:119680731-119680753 TGTGGGGCACAACATGCTGCTGG + Intergenic
996417900 5:123229698-123229720 TGTGGGCCAGAGCAGGCTCCAGG - Intergenic
997465394 5:134084588-134084610 TGGGAACCACAGCAGGCTGGAGG - Intergenic
997815927 5:137017020-137017042 TGGGGGCCACAGCATGCTGCAGG - Intronic
998252434 5:140562034-140562056 TGGGGATCACAGCCTGCAGCCGG + Intronic
1001265091 5:170268435-170268457 GGGGGGGCACAGGAGGCTGCTGG + Exonic
1002307534 5:178292619-178292641 TGGAGGCTACTGCATGCTGCAGG + Intronic
1002335681 5:178476655-178476677 TGGAGTTCACAGAATGCTGCTGG - Intronic
1002674295 5:180897733-180897755 TGGGGGCCAGAGCAGCCTGTAGG + Intergenic
1002763050 6:216730-216752 TGGGGGCGTCTTCATGCTGCCGG + Intergenic
1005425916 6:25702234-25702256 TGGGTGCCTCTGCATGCTCCTGG + Intergenic
1006611138 6:35295261-35295283 TGGGTCCCACACCATGCTGGAGG + Exonic
1006641067 6:35490172-35490194 GGGGGGCCACAGCCTGCTTGAGG - Intronic
1007765740 6:44158841-44158863 TGGGGAGTACAGCATGCTGGTGG - Exonic
1008603192 6:53115787-53115809 TGTGGGCCACAGCTTGCTTTGGG - Intergenic
1017849382 6:158290873-158290895 TGGGTGTCACACCAGGCTGCCGG - Intronic
1018469551 6:164083438-164083460 TGGAGGCTACAGCACCCTGCTGG + Intergenic
1019273992 7:166342-166364 TGGGGGACACAGCAGGACGCAGG + Intergenic
1019347433 7:537961-537983 TGAGGGCCACAGCCTGGTGGGGG - Intergenic
1019718578 7:2554743-2554765 TCGGGGCAACAGCGTGGTGCTGG + Intronic
1019774064 7:2901865-2901887 TGATGGCCACAGCAGGCTGGCGG - Intergenic
1023398900 7:39777200-39777222 TGGGGGCCAAGGCATGTTGGGGG - Intergenic
1024063000 7:45713034-45713056 TGGGGGCAGCAGCATGGTGTCGG - Intronic
1024095548 7:45979718-45979740 TGAGGGCCACACCAGGCTCCTGG + Intergenic
1029588620 7:101492090-101492112 TGGGGGCCAGAGGAAGCCGCTGG + Intronic
1035291458 7:157841865-157841887 TGTGGGCCCCTGCAGGCTGCAGG - Intronic
1035633678 8:1127485-1127507 TGGGAGCCACAGCACCCTCCGGG - Intergenic
1037945623 8:22987796-22987818 TGGCTGCCACAGGTTGCTGCTGG - Intronic
1039730437 8:40269894-40269916 TGGAAGCCACAGCAAGGTGCTGG + Intergenic
1039979448 8:42395219-42395241 TGGGGAAGACAGCATGGTGCTGG - Intronic
1041296124 8:56359061-56359083 TGGCAGCTACAGCATGCTGGAGG + Intergenic
1041395202 8:57383378-57383400 GGAGGTCCACAGCATGGTGCGGG - Intergenic
1042105577 8:65322946-65322968 GGGGTGGCACAGCAGGCTGCAGG + Intergenic
1044582325 8:93834857-93834879 GGGAGGCCACAGCAGGCGGCTGG + Intergenic
1047376405 8:124301407-124301429 TGGCAGCTACAGCATGATGCAGG + Intergenic
1049009251 8:139876339-139876361 TGGGATCCACAGCCTGCTCCAGG + Intronic
1049535964 8:143182274-143182296 TGCAGGGCACAGCTTGCTGCAGG + Intergenic
1049782502 8:144435343-144435365 TGGGGGCCACAGGATCCTCCTGG + Intronic
1054929245 9:70618962-70618984 TGGCAGCCACGGCAAGCTGCAGG + Exonic
1055354035 9:75418772-75418794 TTGGGGCTACAGCATCCTACAGG + Intergenic
1057111228 9:92473024-92473046 TGGGTGCAGCAGCATGCTGATGG + Intronic
1057874263 9:98742052-98742074 TGTGGTCCACAGCACGCTGGTGG - Intronic
1059357172 9:113708895-113708917 AGGTGGCCCCAGCCTGCTGCTGG + Intergenic
1059967819 9:119633184-119633206 AGGGGCCCCCAGCATGCTTCTGG + Intergenic
1060088395 9:120721670-120721692 TGGGTGCCACATCATCGTGCTGG + Intergenic
1060602767 9:124889098-124889120 TGGGTGCTACAGCAAGATGCAGG - Intronic
1062031138 9:134362524-134362546 TCGTGGTCACAGCATGGTGCTGG + Intronic
1062220216 9:135411025-135411047 TGGAGGCCACAGGCGGCTGCAGG - Intergenic
1062591720 9:137277485-137277507 GTGGGGGCACAGCATGCAGCAGG + Intergenic
1062636457 9:137494081-137494103 TGTGGCCCACAGCATGTTGCAGG - Intronic
1187464954 X:19518931-19518953 TGGGGACAACAGCAAGATGCTGG - Intergenic
1187580975 X:20606999-20607021 TGGGGGCTAGAGCAGGCAGCAGG - Intergenic
1190363013 X:49666835-49666857 AGGGGGCCCCAGTCTGCTGCTGG + Intergenic
1190712406 X:53080186-53080208 TAGGGGCCACTGTATGCAGCTGG + Exonic
1193080729 X:77403738-77403760 TGTGAGCCACCGCATCCTGCTGG + Intergenic
1193912920 X:87327672-87327694 TGGTGGCTGCAGCATGCTGGAGG - Intergenic
1195176738 X:102320361-102320383 TGGGGCCCACTGGATGCAGCTGG - Intronic
1195182126 X:102366732-102366754 TGGGGCCCACTGGATGCAGCTGG + Intronic
1195202606 X:102565052-102565074 TGGGGCCCACTGGATGCAGCTGG - Intergenic
1195254848 X:103081249-103081271 TGGGGCCCACTGGATGCAGCTGG + Intronic
1195670042 X:107461961-107461983 AGGGGGCCACTGCAGGCTGGGGG - Intergenic
1198115590 X:133542010-133542032 TGAGGGACATAGCCTGCTGCAGG + Intronic
1200155916 X:153974882-153974904 TGGGGCCCACCGCATCCTCCTGG - Intronic
1200179463 X:154141464-154141486 CGGGGCACACACCATGCTGCTGG + Intergenic