ID: 997817051

View in Genome Browser
Species Human (GRCh38)
Location 5:137029015-137029037
Sequence GGACTCAGTTGACCATAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997817051_997817058 25 Left 997817051 5:137029015-137029037 CCTGCTTATGGTCAACTGAGTCC 0: 1
1: 0
2: 1
3: 5
4: 54
Right 997817058 5:137029063-137029085 AACAAGCACGAATTATAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997817051 Original CRISPR GGACTCAGTTGACCATAAGC AGG (reversed) Intronic
900503944 1:3019850-3019872 GGCCTCAGGTGACCTTCAGCAGG + Intergenic
916935649 1:169625430-169625452 GGAAACAGATGACCATAAGGAGG - Intronic
918224948 1:182472722-182472744 AGACACAGTTGTCCTTAAGCTGG + Intronic
923499321 1:234551253-234551275 GGCCTCGGATGACCAGAAGCTGG - Intergenic
1069378687 10:67820041-67820063 GGTCTCAGCTGACCATCAGTTGG - Intronic
1090202973 11:124869132-124869154 AGAGTCAGTTGACCGTCAGCTGG + Intronic
1091554726 12:1564090-1564112 GAAGTCTGTAGACCATAAGCTGG + Intronic
1096681638 12:53259339-53259361 AGACTCAGCTGACCATTAGCCGG - Intergenic
1104576966 12:129975139-129975161 AGACTCAGTTGACCCCAAACAGG + Intergenic
1108793125 13:53996893-53996915 TGAATCAGTTGACATTAAGCAGG + Intergenic
1113408476 13:110063242-110063264 GGACTCAGAGGACCCTCAGCAGG + Intergenic
1122228118 14:100291475-100291497 AGACTCAGTTGTCCGTCAGCTGG + Exonic
1123999627 15:25744207-25744229 CCACTCAGTTGACTCTAAGCTGG - Intronic
1124594860 15:31083819-31083841 GGACTGAGGTGACCCTCAGCTGG - Intronic
1130005045 15:80087941-80087963 TGAATCATTTGAGCATAAGCTGG + Intronic
1139247494 16:65460173-65460195 GGACTCATTTGTGCATAGGCAGG - Intergenic
1152890731 17:82880369-82880391 GCAATCAGTTGACCCTAAGATGG - Intronic
1152935152 17:83132421-83132443 GGGGTCAGCTGACCATGAGCTGG - Intergenic
1155317804 18:24589850-24589872 GAAATCAGTTGACCTTAAGAGGG + Intergenic
1156527107 18:37777852-37777874 GGACTCAGATGACCAAGAGGGGG + Intergenic
1159859779 18:73633619-73633641 GTACTCAGTAGACCATAAAAAGG + Intergenic
1164325053 19:24183982-24184004 GGACTCATCTGCCTATAAGCTGG + Intergenic
927051582 2:19335531-19335553 TGACACAGTTGACCTTAAGCCGG + Intergenic
938967904 2:136404749-136404771 GGAAGCAGTTGACCAAAAGAGGG - Intergenic
943551075 2:189340095-189340117 GGGCTCTGTAGACCATCAGCAGG + Intergenic
947568840 2:231214920-231214942 GGACTCCTTTGCCCAGAAGCTGG + Exonic
1170940008 20:20840884-20840906 GCACTCAGTTGACCATCAGCTGG - Intergenic
1175740144 20:61414359-61414381 GGACTCAGTGGCCCAAATGCAGG - Intronic
1179137368 21:38691936-38691958 GAACTCAGCTGGCCAAAAGCTGG + Intergenic
956933728 3:74075937-74075959 GGACACAGTTGACTATGAGATGG + Intergenic
957724534 3:84047091-84047113 GGACTTAGGTCCCCATAAGCTGG + Intergenic
959082212 3:101813896-101813918 TGTCCCAGTTGACCATAAGGGGG + Intronic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959500933 3:107105354-107105376 GGACGAAGTGCACCATAAGCAGG - Intergenic
962357296 3:134705671-134705693 GGACTCAGCTCCCCATAAGAAGG - Intronic
962876504 3:139539547-139539569 GGAGCCAGTTGGCCACAAGCGGG + Exonic
967080341 3:186043904-186043926 AGACTATGTTGACCAGAAGCTGG - Intergenic
969087811 4:4669517-4669539 GGTCACCGTTGCCCATAAGCTGG - Intergenic
980389763 4:132128036-132128058 TGACTAAGTTGACCAAAAGAAGG - Intergenic
981534501 4:145785200-145785222 GGCCTCAGTTCACCATTAACAGG - Intronic
986456853 5:7928198-7928220 GGACTCAGCTGACCTCAATCGGG + Intergenic
986464548 5:8008308-8008330 GGACCCACTTGACATTAAGCAGG + Intergenic
986697361 5:10369633-10369655 GGACAAAGTTGACCATAAAAGGG - Intronic
986866156 5:11990202-11990224 GGCCTGACTAGACCATAAGCTGG + Intergenic
992861183 5:80911858-80911880 AAAGTCAGTTGACCATAGGCTGG - Intergenic
995261832 5:110113259-110113281 AGACTCAGTTAAGCATAAACTGG + Intergenic
996825575 5:127677927-127677949 GCACCCAGTTGATCATAGGCAGG - Intergenic
997817051 5:137029015-137029037 GGACTCAGTTGACCATAAGCAGG - Intronic
999422116 5:151453687-151453709 GGACTCAGGAGAACATAATCTGG - Intronic
1007958525 6:45938362-45938384 GGACCCAGTTGACCACAACTCGG + Intronic
1018096662 6:160393195-160393217 GGACCCAGGTGACCATCAGCTGG - Intronic
1019654731 7:2185076-2185098 GCACTCTGTTGTCCAAAAGCAGG + Intronic
1028446692 7:90932588-90932610 GGACTCTGTGGAACATAAGTTGG + Intronic
1033566654 7:142585406-142585428 GGACTCAGGTGACCCAAAGCTGG - Intergenic
1037457015 8:19073726-19073748 TGATTCAGTTGAGAATAAGCAGG - Intronic
1049066856 8:140322975-140322997 GCACTGAGTTGACCAAAGGCTGG + Intronic
1055155083 9:73052924-73052946 TGACAGAGTTGACCATAAGCAGG - Intronic
1057003260 9:91532358-91532380 TGACTGAGTTGTCCATTAGCTGG - Intergenic
1191968038 X:66782505-66782527 GTACTGCTTTGACCATAAGCAGG + Intergenic
1196747245 X:119082048-119082070 TAAGTCAATTGACCATAAGCAGG - Intronic
1199935215 X:152566858-152566880 GGAGTGAGGTGACCATCAGCAGG - Intergenic