ID: 997817702

View in Genome Browser
Species Human (GRCh38)
Location 5:137034618-137034640
Sequence AAACTCGGGTTGTCTCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997817698_997817702 20 Left 997817698 5:137034575-137034597 CCATGGGCTCAGCATTATCAATA 0: 1
1: 0
2: 0
3: 13
4: 137
Right 997817702 5:137034618-137034640 AAACTCGGGTTGTCTCAGAGAGG 0: 1
1: 0
2: 1
3: 2
4: 83
997817699_997817702 -5 Left 997817699 5:137034600-137034622 CCTGTTTTATAGCACAGAAAACT 0: 1
1: 0
2: 9
3: 120
4: 1028
Right 997817702 5:137034618-137034640 AAACTCGGGTTGTCTCAGAGAGG 0: 1
1: 0
2: 1
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997817702 Original CRISPR AAACTCGGGTTGTCTCAGAG AGG Intronic
909985445 1:82155678-82155700 AAGCTTGGGTTTTCTTAGAGTGG - Intergenic
912642663 1:111362034-111362056 TATCTCGGGCTGTCTCAGTGGGG + Intergenic
920214712 1:204353891-204353913 AAACTGGGGCTGTCTCACTGGGG - Intronic
922430071 1:225542693-225542715 AAACTGGGTTTGTCTCACATGGG + Intronic
923566292 1:235079156-235079178 AATATCTGGGTGTCTCAGAGAGG + Intergenic
1064685219 10:17854544-17854566 AAACATGAGTTGTCTCGGAGGGG + Intronic
1064761395 10:18625093-18625115 AAACACAGGCTGTCTCAGTGAGG - Intronic
1064762445 10:18635220-18635242 AAACACAGGCTGTCTCAGTGAGG - Intronic
1065796200 10:29310706-29310728 AAATTCGGGTTCTCTGAGTGGGG - Intronic
1074294082 10:112166428-112166450 AAACTATGGTTGTGTCCGAGTGG - Exonic
1074988046 10:118674625-118674647 TCACTCGGGTCGTCTCAGAACGG + Intronic
1079926733 11:26503166-26503188 AAATTCGCTTTTTCTCAGAGAGG - Intronic
1084856974 11:71995701-71995723 AAACTGGGGTTGTATCATGGGGG - Intronic
1085474369 11:76780672-76780694 AAACTTGGGATGTGTAAGAGGGG + Intergenic
1090067713 11:123517908-123517930 AAACTCAGGTTCTCTCCGGGAGG - Intergenic
1092153731 12:6268691-6268713 AAGCTCAGTTTCTCTCAGAGGGG + Intergenic
1102918706 12:116775572-116775594 AAACTAGGGAAGGCTCAGAGAGG - Intronic
1106544186 13:30716025-30716047 TAACTAGGGCTGTGTCAGAGTGG + Intronic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1123114535 14:105888705-105888727 AAACTGAGCCTGTCTCAGAGAGG + Intergenic
1123116697 14:105898106-105898128 AAACTCAGGGTGTCTCAGAGAGG + Intergenic
1123118753 14:105907360-105907382 AAACTCTGGGTGTCTTGGAGAGG + Intergenic
1123403695 15:20008551-20008573 AAACTCAGGGTGTCTTGGAGAGG + Intergenic
1123513032 15:21015197-21015219 AAACTCAGGGTGTCTTGGAGAGG + Intergenic
1126425994 15:48527434-48527456 AAGCTCTGCTGGTCTCAGAGAGG - Intronic
1128712426 15:69882180-69882202 AAACTCGAGTTTTCTGAGATTGG + Intergenic
1131667170 15:94582613-94582635 AAACTAGGGCAGTCTCAGGGTGG + Intergenic
1140722288 16:77782855-77782877 AAACTCTAGTTGTGTCTGAGGGG - Intergenic
1141838931 16:86561559-86561581 AAGCTGGGGTTGGCTCAGGGTGG + Intergenic
1145998513 17:29117924-29117946 AAAAGAGGGTTGTCTCAGAACGG + Intronic
1148895011 17:50834480-50834502 AAACTCTGGTTTTCACAGACTGG - Intergenic
1152065603 17:78111040-78111062 AAACCCGAGGTGTCCCAGAGAGG - Exonic
1168004399 19:53474886-53474908 TAACTTGGGTTGTCTTGGAGAGG + Intronic
1168134911 19:54344295-54344317 ATACACGGGGTGTCTCTGAGAGG + Intergenic
929817826 2:45249635-45249657 AATCTCGGAATGACTCAGAGTGG + Intergenic
937743203 2:125380082-125380104 GAACTTGCCTTGTCTCAGAGGGG - Intergenic
948033191 2:234836496-234836518 AAACTGGTGTGGCCTCAGAGAGG + Intergenic
948355283 2:237372728-237372750 AAAGTAGGGTGGGCTCAGAGAGG + Intronic
1168940341 20:1706202-1706224 TAACTCTGGTTGTCTCTGACTGG + Intergenic
1170434411 20:16310866-16310888 AAACTCCTCTTTTCTCAGAGTGG + Intronic
1173258978 20:41416277-41416299 AGACCCCGGTTGTTTCAGAGTGG - Intronic
1174086998 20:48016499-48016521 AAGCTCAGGTTGTCTCTTAGGGG - Intergenic
1181066929 22:20311186-20311208 CAACTCGGGTTGTTTGAGGGTGG - Intergenic
1183318997 22:37153686-37153708 GAACGCCGGTTGTCTCAGGGAGG + Intronic
1183610709 22:38902211-38902233 ATACTCTGGAGGTCTCAGAGAGG - Intergenic
951224969 3:20110378-20110400 AAAATAGGGTTGTCTCAGTTTGG + Intronic
953307298 3:41842104-41842126 ATTCTTGGGTTTTCTCAGAGAGG - Intronic
953746502 3:45578120-45578142 GAACTCAGTTAGTCTCAGAGAGG - Intronic
954437234 3:50502865-50502887 AAACCCGGGTTGGGTGAGAGGGG - Intronic
961005367 3:123401820-123401842 AAACCCGGCCTGTCTCAGAAAGG + Intronic
963919641 3:150893227-150893249 AAATTCAGGTTGTCTCAGAAAGG - Intronic
963970461 3:151423815-151423837 AAACTCAGGTTGTCTTAGTTTGG + Intronic
967447391 3:189582889-189582911 AAACATGGGTTATCTGAGAGAGG + Intergenic
968231120 3:197005148-197005170 AAACCCAGGTTGTCTCACAATGG - Intronic
969272398 4:6111690-6111712 AAGCACGGGCTGTCACAGAGGGG - Intronic
972218635 4:36926672-36926694 TGACTCTGATTGTCTCAGAGTGG - Intergenic
973211994 4:47626018-47626040 AAACTTGGAATGTCTAAGAGAGG - Intronic
975714045 4:77188631-77188653 AAACTAGGGTTGTTGCAGAGTGG + Intronic
977595197 4:98871794-98871816 AAACCAGGGTTCTCTCAAAGTGG - Intronic
979430146 4:120619778-120619800 AAGCTCCACTTGTCTCAGAGAGG - Intergenic
980046048 4:127990226-127990248 AAACTCTGCTTATCTCTGAGTGG + Intronic
980337473 4:131495180-131495202 AGGCTCAGGTTGTCTCAGAAAGG - Intergenic
980495060 4:133578930-133578952 GAACTTGCGTTGTCTCAGATGGG + Intergenic
981789884 4:148524600-148524622 TAACTGTAGTTGTCTCAGAGTGG + Intergenic
990148479 5:52788819-52788841 ACCCTCGGGTTGTTCCAGAGTGG + Intronic
990980321 5:61596872-61596894 AAACTCAGGTTTTCTCATACAGG + Intergenic
997217965 5:132130032-132130054 AAAGTTTGGCTGTCTCAGAGAGG - Intergenic
997817702 5:137034618-137034640 AAACTCGGGTTGTCTCAGAGAGG + Intronic
999989298 5:157034618-157034640 TATCTCGGGCTGTCTCAGTGGGG + Intronic
1003893481 6:10584556-10584578 TATCTCAGGTTGTCTCAGTGGGG + Intronic
1019490121 7:1308636-1308658 AGTCTCGGGCTGTCACAGAGGGG + Intergenic
1037050461 8:14366652-14366674 AAACTTGTCTTGTCTCAGATGGG - Intronic
1041313070 8:56536133-56536155 AAACAGGTGTTGTCCCAGAGAGG + Intergenic
1043074637 8:75682889-75682911 AAACTTGAGTTGTCTTAGATGGG - Intergenic
1043626436 8:82266522-82266544 AAAATCTGGGTGGCTCAGAGTGG - Intergenic
1047996357 8:130340269-130340291 ACACCTGGGTTGTCTCTGAGAGG + Intronic
1048902284 8:139050473-139050495 CATCTCAGGCTGTCTCAGAGGGG - Intergenic
1048977077 8:139679107-139679129 AAACTGGGGTTCTCTTAGTGAGG - Intronic
1051531654 9:18110527-18110549 AAGCTCAGGATGTCTCAGATAGG - Intergenic
1051907442 9:22112448-22112470 AAAGTCTGATTGTCTCAGATTGG + Intergenic
1052479288 9:29002092-29002114 AGACTCAGATTGTCTCAGACAGG - Intergenic
1056584516 9:87919649-87919671 GGACTGGGGTGGTCTCAGAGAGG - Intergenic
1056612350 9:88133271-88133293 GGACTGGGGTGGTCTCAGAGAGG + Intergenic
1061467036 9:130789111-130789133 AACCTTGGGTTCTCTTAGAGTGG + Intronic
1188895259 X:35659407-35659429 CAAGTCTTGTTGTCTCAGAGGGG + Intergenic
1201767815 Y:17589106-17589128 AAGTTCGGGTTTTATCAGAGAGG + Intergenic
1201833738 Y:18316879-18316901 AAGTTCGGGTTTTATCAGAGAGG - Intergenic