ID: 997818357

View in Genome Browser
Species Human (GRCh38)
Location 5:137039602-137039624
Sequence GTCCCACGCCCCCATGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997818348_997818357 21 Left 997818348 5:137039558-137039580 CCACCTCTCTGGCTCTCCTACAA 0: 1
1: 0
2: 1
3: 23
4: 311
Right 997818357 5:137039602-137039624 GTCCCACGCCCCCATGGGCAGGG No data
997818350_997818357 5 Left 997818350 5:137039574-137039596 CCTACAAACCAGATCATCCATGC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 997818357 5:137039602-137039624 GTCCCACGCCCCCATGGGCAGGG No data
997818347_997818357 25 Left 997818347 5:137039554-137039576 CCTGCCACCTCTCTGGCTCTCCT 0: 1
1: 0
2: 36
3: 119
4: 726
Right 997818357 5:137039602-137039624 GTCCCACGCCCCCATGGGCAGGG No data
997818349_997818357 18 Left 997818349 5:137039561-137039583 CCTCTCTGGCTCTCCTACAAACC 0: 1
1: 0
2: 1
3: 17
4: 219
Right 997818357 5:137039602-137039624 GTCCCACGCCCCCATGGGCAGGG No data
997818352_997818357 -3 Left 997818352 5:137039582-137039604 CCAGATCATCCATGCAACAGGTC 0: 1
1: 0
2: 1
3: 7
4: 59
Right 997818357 5:137039602-137039624 GTCCCACGCCCCCATGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997818357 Original CRISPR GTCCCACGCCCCCATGGGCA GGG Intronic
No off target data available for this crispr