ID: 997819673

View in Genome Browser
Species Human (GRCh38)
Location 5:137053618-137053640
Sequence GCCGAAGCCCAGAAAGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 180}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997819673_997819685 25 Left 997819673 5:137053618-137053640 CCAGGTTCTTTCTGGGCTTCGGC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 997819685 5:137053666-137053688 TGGGTCTGAAGCTTTAGGCTTGG 0: 1
1: 0
2: 1
3: 11
4: 147
997819673_997819674 -6 Left 997819673 5:137053618-137053640 CCAGGTTCTTTCTGGGCTTCGGC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 997819674 5:137053635-137053657 TTCGGCTCAGTCATCCTTAATGG 0: 1
1: 0
2: 0
3: 5
4: 55
997819673_997819678 0 Left 997819673 5:137053618-137053640 CCAGGTTCTTTCTGGGCTTCGGC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 997819678 5:137053641-137053663 TCAGTCATCCTTAATGGGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 92
997819673_997819677 -1 Left 997819673 5:137053618-137053640 CCAGGTTCTTTCTGGGCTTCGGC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 997819677 5:137053640-137053662 CTCAGTCATCCTTAATGGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 100
997819673_997819675 -5 Left 997819673 5:137053618-137053640 CCAGGTTCTTTCTGGGCTTCGGC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 997819675 5:137053636-137053658 TCGGCTCAGTCATCCTTAATGGG 0: 1
1: 0
2: 0
3: 2
4: 53
997819673_997819684 20 Left 997819673 5:137053618-137053640 CCAGGTTCTTTCTGGGCTTCGGC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 997819684 5:137053661-137053683 GGGGGTGGGTCTGAAGCTTTAGG 0: 1
1: 0
2: 2
3: 12
4: 234
997819673_997819679 1 Left 997819673 5:137053618-137053640 CCAGGTTCTTTCTGGGCTTCGGC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 997819679 5:137053642-137053664 CAGTCATCCTTAATGGGTGGGGG 0: 1
1: 0
2: 0
3: 11
4: 102
997819673_997819676 -2 Left 997819673 5:137053618-137053640 CCAGGTTCTTTCTGGGCTTCGGC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 997819676 5:137053639-137053661 GCTCAGTCATCCTTAATGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 87
997819673_997819680 2 Left 997819673 5:137053618-137053640 CCAGGTTCTTTCTGGGCTTCGGC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 997819680 5:137053643-137053665 AGTCATCCTTAATGGGTGGGGGG 0: 1
1: 0
2: 0
3: 10
4: 92
997819673_997819682 6 Left 997819673 5:137053618-137053640 CCAGGTTCTTTCTGGGCTTCGGC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 997819682 5:137053647-137053669 ATCCTTAATGGGTGGGGGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 189
997819673_997819681 5 Left 997819673 5:137053618-137053640 CCAGGTTCTTTCTGGGCTTCGGC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 997819681 5:137053646-137053668 CATCCTTAATGGGTGGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997819673 Original CRISPR GCCGAAGCCCAGAAAGAACC TGG (reversed) Intronic
900523749 1:3118590-3118612 GGCAAAGCCGGGAAAGAACCAGG + Intronic
900955291 1:5882993-5883015 TCTGAAGCCCAGGAAGAACAGGG + Intronic
901770898 1:11529883-11529905 GCCGAAGACCACAAAGACCATGG - Exonic
907291793 1:53418748-53418770 GCCAAAGGCCTGAAAGAGCCCGG + Intergenic
907840194 1:58149524-58149546 TCCGAAGCCCTGTATGAACCCGG - Intronic
907999508 1:59666646-59666668 GGTGAAGCCCTGAAACAACCAGG + Intronic
910602124 1:89043422-89043444 GCTGAAGCCCATAAAAACCCTGG - Intergenic
910999735 1:93150376-93150398 GCCAAAACCCGGAAACAACCTGG - Exonic
913958424 1:143322440-143322462 GCTGATGCCAAGAAAGAGCCAGG + Intergenic
914052741 1:144147820-144147842 GCTGATGCCAAGAAAGAGCCAGG + Intergenic
914126456 1:144818721-144818743 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
914381352 1:147119287-147119309 GCCAAAGTCCAGAAAGATGCTGG - Intergenic
920507652 1:206527749-206527771 GCCCAAGGCCAGAAAGAGCCTGG - Intronic
920656854 1:207883146-207883168 GCCGAGTACCAGAAAGATCCGGG - Intergenic
921067392 1:211632581-211632603 GCCGAGGCCTAGAAAGGACAGGG + Intergenic
921198822 1:212784404-212784426 GCAGTATCCCAGAAAGATCCTGG - Exonic
923946977 1:238899076-238899098 GCCAAAGGCCAGAAAGCCCCAGG + Intergenic
1064072278 10:12240851-12240873 GCAGAAGACCAGACACAACCTGG - Intronic
1064372168 10:14762108-14762130 GCAGAAGACAAGAAAGAACCTGG - Intronic
1064451020 10:15442223-15442245 GCCGGAGGCCAGAAAGAGCGTGG - Intergenic
1066759238 10:38738124-38738146 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
1066962385 10:42234646-42234668 GCTGATGCCAAGAAAGAGCCAGG + Intergenic
1069307488 10:66988956-66988978 ACCAAAGCCCAGGAAGCACCCGG - Intronic
1069721420 10:70551951-70551973 CACGAAGCCCAGAAGGAAACGGG - Intronic
1070061296 10:72985645-72985667 ACAGAAGCTCTGAAAGAACCAGG + Intergenic
1071061025 10:81570919-81570941 GCCTAGGCCCAGCAAGGACCTGG - Intergenic
1071843221 10:89494740-89494762 GCAGAATCCCAGAAAGACTCAGG + Intronic
1072719707 10:97772884-97772906 GTCAGAGCCCAGAAACAACCAGG + Intergenic
1074283583 10:112076882-112076904 GCCAAAGGCCCGAAAGACCCTGG - Intergenic
1075112269 10:119596857-119596879 GCCGAAGCCCAGCCAGCTCCGGG + Intronic
1075468788 10:122672415-122672437 TCCGAGACCCAGAGAGAACCAGG - Intergenic
1076406456 10:130215310-130215332 TCAGAAGCCCAGAAGGACCCAGG - Intergenic
1076558342 10:131344865-131344887 GCAGAAGCCCAGAAAGCACATGG - Intergenic
1077245956 11:1538423-1538445 GCAGAAAGGCAGAAAGAACCTGG + Intergenic
1077616205 11:3675861-3675883 GCAGAATCCCCCAAAGAACCAGG - Exonic
1077792844 11:5460682-5460704 GCCAACGCAGAGAAAGAACCAGG - Intronic
1084010466 11:66345505-66345527 GGCGAAGCCCTGAGAGAACCAGG + Exonic
1085051143 11:73380892-73380914 GCCTAGGCCCAGAAAGACACGGG - Intronic
1086281522 11:85195064-85195086 TCTGAAGCCCAGGAAGAACAAGG + Intronic
1087567996 11:99887662-99887684 GCCGAAGGCCTGAAAGCCCCTGG + Intronic
1090931744 11:131303926-131303948 GCGGGAGCACAGAAAGCACCAGG - Intergenic
1091885836 12:4016398-4016420 GCAGCAGCCCAGATAGAAACAGG + Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1093398776 12:18716596-18716618 GCCGAAGTCAAGAGAGAAACAGG - Intronic
1096038851 12:48496395-48496417 TCCACAGCCCAGGAAGAACCAGG - Exonic
1098059381 12:66544064-66544086 CCGGAAGCCCAGGAAGCACCTGG - Intronic
1098816278 12:75168402-75168424 GCCTAAGGCCATAAAGAAGCTGG + Intronic
1104980080 12:132569814-132569836 GCCGGAGCCCAGACATAGCCTGG + Intronic
1105924802 13:24998244-24998266 TACGTAGCCCACAAAGAACCTGG - Intergenic
1107413448 13:40178642-40178664 GCAGAACGACAGAAAGAACCTGG + Intergenic
1112412551 13:99176798-99176820 GCAGAAGCCGAGGTAGAACCGGG - Intergenic
1112742108 13:102486675-102486697 GCTGAAGGCCTGAGAGAACCTGG - Intergenic
1121889525 14:97576084-97576106 GACAAAGCACAGAAAGATCCAGG - Intergenic
1202929989 14_KI270725v1_random:27750-27772 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
1128133488 15:65246106-65246128 GCCGAGGCCCTGAGAGAAGCAGG - Intronic
1128861464 15:71077693-71077715 GCACAAGCCCAGAAGCAACCTGG - Intergenic
1129045322 15:72728932-72728954 GCCAAAGCCCAGGAAGACCCAGG - Intronic
1129717294 15:77859842-77859864 GCAGAGGCCCAGACAGGACCAGG + Intergenic
1130243225 15:82217959-82217981 GCCAAAGGCCAGAAAAAATCTGG + Intronic
1130461741 15:84164457-84164479 GCAGAGGCCCAGACAGGACCAGG - Intergenic
1130916752 15:88311111-88311133 GCAGAAGGAAAGAAAGAACCTGG - Intergenic
1134043895 16:11087607-11087629 GCCTGAGGCCAAAAAGAACCTGG - Intronic
1135206988 16:20492427-20492449 GCCCAGGCCCAGCAAGAACCTGG + Intergenic
1135211897 16:20531205-20531227 GCCCAGGCCCAGCAAGAACCTGG - Intergenic
1135658084 16:24269042-24269064 ACCCAAGGCCAGTAAGAACCAGG - Intronic
1136773391 16:32859272-32859294 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
1136862433 16:33711856-33711878 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
1136897223 16:34002247-34002269 GCTGATGCCAAGAAAGAGCCAGG + Intergenic
1138517068 16:57541972-57541994 CCTGAAGCCCAGAGAGGACCTGG - Intergenic
1139309282 16:66014674-66014696 GCCAAAGCCGAGGAAGAACATGG - Intergenic
1203075807 16_KI270728v1_random:1121382-1121404 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
1203123926 16_KI270728v1_random:1560039-1560061 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
1143017195 17:3897242-3897264 ACCGAAGGCCAGGAAGAAACAGG + Exonic
1143103205 17:4515132-4515154 ACAGAACCGCAGAAAGAACCAGG - Intronic
1143887711 17:10077489-10077511 GCAGAAGCTCAGAAAGGCCCAGG + Intronic
1146425747 17:32736468-32736490 GCGGAAGGACAGAAAGAACTTGG + Intronic
1146896247 17:36544503-36544525 GCAGAGGCCCAGAGAGGACCTGG - Intergenic
1148792770 17:50183059-50183081 TCAGAAGTCCAGAGAGAACCAGG - Intergenic
1149187407 17:54015882-54015904 GCCAAAGGCCAGAGAGAACCTGG + Intergenic
1151593269 17:75060959-75060981 ACCCATGCCCAGTAAGAACCAGG - Intronic
1151888843 17:76940338-76940360 GCCACAGCCCAGTAAGCACCAGG - Intronic
1152100992 17:78301710-78301732 GGCATAGCCCAGAAAGGACCGGG + Intergenic
1155618266 18:27746246-27746268 GCCAAAGGCCAGAAAGCCCCTGG - Intergenic
1155916469 18:31562358-31562380 TCTGAAGCACAGAGAGAACCTGG + Intergenic
1157519620 18:48336655-48336677 GATGAAGACCAGAAAGAGCCAGG - Intronic
1160431527 18:78816380-78816402 GAGGACACCCAGAAAGAACCTGG - Intergenic
1161357605 19:3827608-3827630 GCAGAAGCACAGAAAGAAGGAGG - Exonic
1161494365 19:4579532-4579554 ACTGAAGCCCAGAAAGGACTAGG + Intergenic
1162577612 19:11507916-11507938 GCCTAGGCCCAGCGAGAACCTGG + Intronic
1163326607 19:16607599-16607621 CCCGGAGCCCTGAGAGAACCCGG + Intronic
1164795943 19:31030176-31030198 TCCCAAGCCCAGAGAGCACCCGG + Intergenic
1166913872 19:46180736-46180758 GCGGAAGCCCTGAGAGCACCTGG + Intergenic
1202692137 1_KI270712v1_random:100244-100266 GCTGATGCCAAGAAAGAGCCAGG + Intergenic
925590334 2:5503018-5503040 GCAGAAACTCAGAAAGAGCCTGG - Intergenic
926577782 2:14601232-14601254 GCCGAAGGCCAGAGAGCCCCTGG - Intergenic
926625290 2:15085511-15085533 GCCCAGGCCCAGCAAGGACCTGG + Intergenic
933954262 2:87353728-87353750 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
934238457 2:90249948-90249970 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
934322569 2:91982473-91982495 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
934460880 2:94213290-94213312 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
935903885 2:107822518-107822540 CCCGAAGTGCAGAAAGAGCCTGG - Intergenic
939885558 2:147677612-147677634 GAGGAAGCCCAAACAGAACCTGG + Intergenic
940828130 2:158436601-158436623 GCAGAAGGCAAGAAATAACCAGG + Intronic
941011606 2:160306385-160306407 TCAGAATCCCAGAAAGAACTGGG + Intronic
946113214 2:217438232-217438254 GCAGGAGGACAGAAAGAACCAGG - Intronic
947654138 2:231811708-231811730 GCAGAATCCCAGGAAGAAACAGG - Intergenic
1170445034 20:16417537-16417559 TCCTCAGCACAGAAAGAACCAGG + Intronic
1171035517 20:21709767-21709789 ACAGAAACCCAGAAAGAAGCAGG - Intronic
1172271086 20:33656291-33656313 GCCTCAGCCCAGTAAGGACCTGG + Intergenic
1173002501 20:39114590-39114612 GCCCCTGCCCAGAAAGAACAAGG - Intergenic
1173268646 20:41511037-41511059 ACTGAAGCCCAGAACGATCCAGG - Intronic
1174587274 20:51618892-51618914 GCCGAAGCCGGGTAAGACCCAGG + Intronic
1176592006 21:8656332-8656354 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
1177028462 21:15952200-15952222 GCAGAAGACAAGAAATAACCAGG - Intergenic
1179959409 21:44759638-44759660 GCCACAACCCAGAAAGAGCCTGG + Intergenic
1180274855 22:10633461-10633483 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
1180549321 22:16528377-16528399 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
1181315380 22:21967768-21967790 GCCCAACGCCAGGAAGAACCAGG + Intronic
1181355371 22:22293459-22293481 GCTGATGCCAAGAAAGAGCCAGG + Intergenic
1182646617 22:31815221-31815243 GCTGAAGCACAGACAGAGCCAGG + Intronic
951051920 3:18103402-18103424 ACTTAAGCCCAGAAAGAACATGG - Intronic
951520071 3:23603142-23603164 GCTGAAGGCCAGACAGCACCAGG - Intergenic
952404445 3:32992938-32992960 GCCAAAACCCAGAAACCACCTGG + Intergenic
953167837 3:40481483-40481505 GAGGAAGACCAGAAAGAAGCTGG + Intronic
958942969 3:100335007-100335029 GGCGAGGCCCAGAAAGCACCAGG + Intronic
967292009 3:187930361-187930383 GCTGAAGGTCAGAAAGAATCTGG + Intergenic
969141483 4:5077977-5077999 GCAGCAGGACAGAAAGAACCAGG - Intronic
969484149 4:7462472-7462494 GCAGAAGCCCAGATAAAAGCAGG + Intronic
969625760 4:8304585-8304607 GCTGAGTCCCAGAAAGACCCAGG - Intronic
969632379 4:8346227-8346249 ACTGAGGCCCAGAAAGAGCCAGG - Intergenic
971004402 4:22357285-22357307 CCCAAAGCCCAGAGAGGACCTGG + Intronic
975886672 4:78974569-78974591 GATGGAGCCCAGAAATAACCTGG - Intergenic
979975345 4:127189415-127189437 GACAAAGCCCAGAAACAACTGGG + Intergenic
981080888 4:140637843-140637865 ACCGAAGCCCAGAAAGATGGAGG - Intronic
982904493 4:161050402-161050424 GCTGAAGACCAGAGAGACCCTGG + Intergenic
985510078 5:308456-308478 GCCGCACCCCAGGAAAAACCTGG - Intronic
986066745 5:4241295-4241317 GCCTTAGCCCAGGAAGAATCAGG + Intergenic
987999449 5:25330531-25330553 GCCAAGGCCCAGCAAGGACCTGG + Intergenic
992991148 5:82285118-82285140 GACAGAGCCCAGAAAGAACAGGG + Intronic
994692368 5:103034588-103034610 TCCAAAGCCCAGAAAAACCCTGG - Intergenic
997819673 5:137053618-137053640 GCCGAAGCCCAGAAAGAACCTGG - Intronic
998873068 5:146572035-146572057 GCAGAAGACAAGAAATAACCAGG - Intergenic
1000896061 5:166857012-166857034 CCTCAAGCCCACAAAGAACCTGG + Intergenic
1000925283 5:167186465-167186487 GCTGAAGCGAAGAAAGAATCAGG + Intergenic
1001372637 5:171221143-171221165 GCCCAACCCCAGTAGGAACCAGG + Intronic
1001429456 5:171647763-171647785 GCCTCTGCCCAGAGAGAACCTGG - Intergenic
1001674577 5:173501323-173501345 CCCCAAGTCCAGAGAGAACCCGG + Intergenic
1002158535 5:177301666-177301688 ACCCAAGCCCAGAAAGGAGCTGG + Exonic
1002695337 5:181084865-181084887 CCCAAAGCCTAGAAAGCACCAGG + Intergenic
1006682338 6:35805960-35805982 GCCCAAGGCCACAAAGAACATGG - Exonic
1006738479 6:36291728-36291750 ACAGAAGCCCAGGACGAACCAGG + Intronic
1007249020 6:40483018-40483040 GCCAAAGCCCAGAAGGCACCAGG + Intronic
1013281296 6:108639465-108639487 GGCAAAGCACAGAAAGAACATGG - Intronic
1016918848 6:149271409-149271431 GCCACAGGCTAGAAAGAACCTGG - Intronic
1018530244 6:164755309-164755331 GCCGAAGACCTGAAAGCCCCTGG - Intergenic
1019155030 6:170032908-170032930 GCCCCAGCCCATAAAGAACAGGG + Intergenic
1020043154 7:5019458-5019480 GCCGACGTCCAGAAAGGAACTGG + Intronic
1024001347 7:45191247-45191269 GCTGAGCCCCACAAAGAACCAGG + Intergenic
1025582342 7:62736339-62736361 TCTGAAGCCCAGGAAGAACAAGG + Intergenic
1026377424 7:69765830-69765852 GCCTCAGCCCCGAAAGTACCTGG - Intronic
1029269757 7:99370101-99370123 GCAGAAAGCCAGCAAGAACCTGG + Intronic
1030899554 7:115105427-115105449 GCAGAAGCCAAGAAACACCCAGG + Intergenic
1032745797 7:134784726-134784748 GCAGAAGCCCAAATAGGACCAGG + Intronic
1032858748 7:135858569-135858591 GCCCAGGCCCAGAGAGGACCTGG - Intergenic
1034334225 7:150310142-150310164 GCTGTAGCCCAGGAATAACCAGG - Intronic
1036175295 8:6532013-6532035 CCCGGAGTCCAGAAAGCACCAGG + Intronic
1036690106 8:10939885-10939907 CCCGAAGCCCAGGGAGAAGCTGG - Intronic
1037605933 8:20437100-20437122 GCAGAAAGCCAGAAAGCACCCGG - Intergenic
1039340779 8:36647507-36647529 GGAGAAGCCCAGGAAGAAGCAGG + Intergenic
1043962124 8:86429056-86429078 GCAAAAGGGCAGAAAGAACCCGG - Intronic
1044391945 8:91662002-91662024 GCAGAAGGCCAGCAAGATCCTGG - Intergenic
1044948639 8:97414601-97414623 GCCGAAGCCCAGCAGAAAACTGG - Intergenic
1046387299 8:113520915-113520937 GACCAAGCCCAGAAAAAATCTGG + Intergenic
1050166857 9:2773891-2773913 GCAGAAGACAAGAAATAACCAGG + Intronic
1052447088 9:28577027-28577049 GCCCAAGCCCAGGAATGACCAGG - Intronic
1055203775 9:73701265-73701287 GCCAAAGCCAAGGAAGAAACTGG + Intergenic
1057255180 9:93540596-93540618 GACACAGCCCAGAAAGAAACAGG - Intronic
1057521235 9:95762241-95762263 GCTAAAGCCAAGAAAGACCCAGG + Intergenic
1061808234 9:133148334-133148356 GCCCCAGCCCAGACAGATCCTGG + Intronic
1062178612 9:135178596-135178618 GCCGGAGCCCAGGAACAACGGGG + Intergenic
1203622055 Un_KI270749v1:135179-135201 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
1185849152 X:3469148-3469170 GCCGAAGGCCTGAAAGCGCCTGG - Intergenic
1188417700 X:29956237-29956259 GCAGAACCCGAGAAAGAATCCGG - Exonic
1193468873 X:81876007-81876029 GCCCTAGCCCAGCAAGGACCTGG - Intergenic
1196904865 X:120421093-120421115 GCAGAATGCAAGAAAGAACCAGG + Intergenic
1199425581 X:147697440-147697462 CCAGAAGCACAAAAAGAACCTGG - Intergenic
1199502712 X:148526501-148526523 GCTGAAGCAGAGAAAGTACCAGG - Intronic
1201190064 Y:11437649-11437671 GCTGATGCCAAGAAAGAGCCAGG - Intergenic
1202377527 Y:24250693-24250715 GCAGAGGCCCAGACAGGACCAGG + Intergenic
1202493254 Y:25419429-25419451 GCAGAGGCCCAGACAGGACCAGG - Intergenic
1202583565 Y:26404278-26404300 GCTGATGCCAAGAAAGAGCCAGG + Intergenic