ID: 997822080

View in Genome Browser
Species Human (GRCh38)
Location 5:137075365-137075387
Sequence TCCCGCTAGAGGGCGGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997822072_997822080 26 Left 997822072 5:137075316-137075338 CCAGTGGCTTGCCACTCTCAGGT 0: 1
1: 0
2: 0
3: 10
4: 120
Right 997822080 5:137075365-137075387 TCCCGCTAGAGGGCGGCTCTCGG 0: 1
1: 0
2: 1
3: 4
4: 49
997822069_997822080 28 Left 997822069 5:137075314-137075336 CCCCAGTGGCTTGCCACTCTCAG No data
Right 997822080 5:137075365-137075387 TCCCGCTAGAGGGCGGCTCTCGG 0: 1
1: 0
2: 1
3: 4
4: 49
997822070_997822080 27 Left 997822070 5:137075315-137075337 CCCAGTGGCTTGCCACTCTCAGG No data
Right 997822080 5:137075365-137075387 TCCCGCTAGAGGGCGGCTCTCGG 0: 1
1: 0
2: 1
3: 4
4: 49
997822073_997822080 15 Left 997822073 5:137075327-137075349 CCACTCTCAGGTGTTGCAGTTAC 0: 1
1: 0
2: 0
3: 5
4: 116
Right 997822080 5:137075365-137075387 TCCCGCTAGAGGGCGGCTCTCGG 0: 1
1: 0
2: 1
3: 4
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997822080 Original CRISPR TCCCGCTAGAGGGCGGCTCT CGG Intronic