ID: 997823283

View in Genome Browser
Species Human (GRCh38)
Location 5:137084851-137084873
Sequence GGACCCCGAGGAAAAGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997823283_997823291 19 Left 997823283 5:137084851-137084873 CCAAATGCTTTTCCTCGGGGTCC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 997823291 5:137084893-137084915 AGGAAGCAAAGCACTTGCTTTGG No data
997823283_997823292 20 Left 997823283 5:137084851-137084873 CCAAATGCTTTTCCTCGGGGTCC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 997823292 5:137084894-137084916 GGAAGCAAAGCACTTGCTTTGGG 0: 1
1: 0
2: 1
3: 17
4: 341
997823283_997823286 -1 Left 997823283 5:137084851-137084873 CCAAATGCTTTTCCTCGGGGTCC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 997823286 5:137084873-137084895 CTTACACCCATATCCCTCTAAGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997823283 Original CRISPR GGACCCCGAGGAAAAGCATT TGG (reversed) Intronic