ID: 997823929

View in Genome Browser
Species Human (GRCh38)
Location 5:137089685-137089707
Sequence GATGGGACTTTGGAGTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 815
Summary {0: 1, 1: 0, 2: 8, 3: 213, 4: 593}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997823929 Original CRISPR GATGGGACTTTGGAGTTGAG GGG (reversed) Intronic
900722417 1:4185975-4185997 GATGGGATATTGGCATTGAGTGG + Intergenic
900840928 1:5047825-5047847 GATGGGATATTGGCGTTGAGTGG - Intergenic
900847615 1:5116100-5116122 GATGGGATATTGGCATTGAGTGG - Intergenic
902051058 1:13563849-13563871 GATGGGATATTGGCGTTGAGCGG - Intergenic
903071704 1:20730076-20730098 GATGTGACTGTGAAGTTGAAAGG - Intronic
903965882 1:27089193-27089215 GATGGGACTCTGGATTTTTGAGG + Intergenic
904394090 1:30206362-30206384 GATGGGATATTGGCATTGAGCGG - Intergenic
904711762 1:32435316-32435338 GATGGGATATTGGCATTGAGTGG - Intergenic
905721728 1:40209120-40209142 GAGGGGACTTTGAAGTTCTGAGG + Intronic
906081042 1:43088480-43088502 GATGGGATATTGGCATTGAGCGG - Intergenic
906670221 1:47648895-47648917 AGTGGGAATTTGGAGTTGGGGGG + Intergenic
906744386 1:48211715-48211737 GATGGGATATTGGCATTGAGCGG + Intergenic
907292756 1:53427270-53427292 GATGGGATATTGGCGTTTAGTGG - Intergenic
907521397 1:55025572-55025594 GATGGGATATTGGCATTGAGTGG - Intergenic
908461577 1:64352700-64352722 GATGGGATATTGGCGTTGAGTGG + Intergenic
908591818 1:65644611-65644633 GATGGGATATTGGCATTGAGTGG + Intergenic
908852545 1:68389241-68389263 GATGGGATATTGGCGTTGAGTGG - Intergenic
909035601 1:70591273-70591295 GATGGGATATTGGCATTGAGTGG - Intergenic
909222534 1:72982574-72982596 GATGGGATATTGGCATTGAGTGG + Intergenic
909223526 1:72990548-72990570 GATGGGATATTGGCATTGAGTGG + Intergenic
909519273 1:76548223-76548245 GAGGGGACATTTAAGTTGAGAGG - Intronic
909776555 1:79491300-79491322 GATGGGATATTGGCATTGAGCGG + Intergenic
909910100 1:81248416-81248438 GATGGGACATTGGCACTGAGCGG - Intergenic
910226859 1:84944624-84944646 TATAGGAATTTGGAGATGAGGGG - Intronic
911147851 1:94569597-94569619 GATGGGATACTGGCGTTGAGTGG + Intergenic
911570523 1:99512597-99512619 AATGGGATATTGGCGTTGAGTGG - Intergenic
912536031 1:110371828-110371850 GAAGGGACTTTGGGGTGGAGTGG + Intronic
912778034 1:112518687-112518709 GAAGGAACTTTGGAGTTAGGAGG + Intronic
912815122 1:112822885-112822907 GATGGGATATTGGCATTGAGTGG + Intergenic
913095650 1:115513307-115513329 GATGGGATATTGGGGTTGAGTGG + Intergenic
913167536 1:116202102-116202124 GATGGTACTTTGGGTTTGCGTGG - Intergenic
913245257 1:116865064-116865086 GATGGGATATTGGTGTTGAGCGG - Intergenic
913365528 1:118033833-118033855 GATGGGACTTTAGAGCTGAGTGG - Intronic
914910761 1:151784285-151784307 GATGGGACTATCCAGTAGAGAGG - Intronic
915791385 1:158675439-158675461 GATGGAAATTTGCAGATGAGTGG + Intronic
916328990 1:163593990-163594012 GATGGGATATTGGCGTTGAGTGG - Intergenic
917022305 1:170602391-170602413 TGTGGGACTTTGGACTTGAGCGG - Intergenic
917200792 1:172512651-172512673 GATGGGAATTTGGAACTGATGGG + Intergenic
917749796 1:178042955-178042977 GATGGGATATTGGCATTGAGTGG - Intergenic
917985330 1:180311240-180311262 GATGGGACTTTGGAGGCAAGAGG + Intronic
918203544 1:182289262-182289284 GCTGGGATTTTAGACTTGAGAGG + Intergenic
918347252 1:183616625-183616647 GATGGGATATTGGTGTCGAGTGG - Intergenic
918567534 1:185951032-185951054 GATGGGATATTGGTGTCGAGTGG + Intronic
918714268 1:187768242-187768264 GATGGGATATTGGCATTGAGCGG + Intergenic
918766902 1:188498685-188498707 TGTGGGACTTTGAACTTGAGAGG + Intergenic
919476537 1:198037758-198037780 GATGGGATATTGGCTTTGAGCGG - Intergenic
919636344 1:200007039-200007061 AGTGGGACTTTGGAGCTGAAAGG - Intergenic
920366977 1:205453350-205453372 GATGGGACCTCGGAGCAGAGGGG - Intronic
920425538 1:205872196-205872218 GATGGGATGTTGGCATTGAGTGG - Intergenic
920901399 1:210113550-210113572 GATGGGATATTGGTGTTGAGCGG + Intronic
921212552 1:212912478-212912500 GATGGGATATTGGCGTTGAGTGG - Intergenic
921459641 1:215412679-215412701 GACGGGATATTGGCGTTGAGTGG + Intergenic
921584455 1:216931068-216931090 TGTGGGACTTGGAAGTTGAGAGG + Intronic
921732841 1:218596525-218596547 GATGGGATATTGGCGTTGAGTGG + Intergenic
922049404 1:221975839-221975861 GATGGGATATTGGCGTTGAGTGG + Intergenic
922153932 1:223027143-223027165 GATGGGATATTGGCGTTGAGTGG + Intergenic
922363407 1:224843192-224843214 GATGGGATATTGGCATTGAGTGG + Intergenic
922877217 1:228949209-228949231 GATGGGATCTTGGCATTGAGCGG - Intergenic
922906527 1:229177397-229177419 GATGGGATATTGGCGTTGAGTGG - Intergenic
922931178 1:229390923-229390945 GAAGTGAATTTGGAGCTGAGGGG + Intergenic
922934952 1:229415348-229415370 GATGGGATATTGGCGTTGAGCGG - Intergenic
923075343 1:230604193-230604215 GATGGGATATTGGCGTTGAGTGG - Intergenic
923244888 1:232121156-232121178 GATGGGATATTGGCGTTGAGTGG - Intergenic
923257208 1:232232368-232232390 GATGGGATATTGGCGTTGAGTGG + Intergenic
924180787 1:241436944-241436966 GATGGGATATTGGCATTGAGCGG - Intergenic
1063441314 10:6075605-6075627 GAGGGGACTGTGGGGTGGAGGGG - Intergenic
1063509460 10:6632332-6632354 GATGGGATATTGGCGTTGAGTGG + Intergenic
1063527546 10:6799832-6799854 GATGGGATATTGGCATTGAGTGG + Intergenic
1063636310 10:7786519-7786541 GGTGGGCCTTTGGAGATGACTGG + Intronic
1065442988 10:25771487-25771509 GATGGGATATTGGCGTTGAGTGG + Intergenic
1065533698 10:26697977-26697999 GGTGGGACTCCGGAGCTGAGGGG + Intronic
1067705474 10:48603921-48603943 GATGGGTCTTTGGAGGTGGATGG - Intronic
1068058214 10:52036502-52036524 GATGGGATATTGGCGTTGAGTGG + Intronic
1068179521 10:53501769-53501791 GATGGGATATTGGCGTTGAGTGG + Intergenic
1068231107 10:54169729-54169751 GATGGGATGTCGGCGTTGAGTGG - Intronic
1068359993 10:55965406-55965428 GATGAGACTTTGGACTTTAGAGG - Intergenic
1068360904 10:55974173-55974195 GATGGGATATTGGTGTTGAGCGG - Intergenic
1068592205 10:58863752-58863774 GATGGGATATTGGCGTTGAGTGG + Intergenic
1069124174 10:64608405-64608427 AATTGGAATTTGGATTTGAGGGG + Intergenic
1070475061 10:76821551-76821573 GATGGGATATTGGCGTTGAGTGG - Intergenic
1070479688 10:76870162-76870184 GATGGGACTCTGGTTTTGTGTGG + Intronic
1070486288 10:76934981-76935003 GATGGGACTTCGGAGCTGTAAGG - Intronic
1071187365 10:83060121-83060143 GATGGGATACTGAAGTTGAGTGG - Intergenic
1071456134 10:85852922-85852944 GATGGCATTTTGGAGCTCAGAGG - Intronic
1071550655 10:86563976-86563998 GATGGGATATTGGCATTGAGCGG + Intergenic
1071821867 10:89287668-89287690 GATGGGATATTGGCATTGAGTGG - Intronic
1071897605 10:90083774-90083796 GATGGGATATTGGCGTTCAGTGG + Intergenic
1071916333 10:90297971-90297993 GATGGGATATTGCCGTTGAGCGG - Intergenic
1071928644 10:90440594-90440616 GGTGGGAATTTGGAGTTCTGGGG - Intergenic
1071961249 10:90810399-90810421 GATGGGATACTGGCGTTGAGTGG - Intronic
1072003151 10:91217685-91217707 GATGGCACTTAGGAGTGAAGTGG - Intronic
1072252047 10:93589382-93589404 GATGGGACCTTGGAGGTGAGTGG + Exonic
1072580400 10:96735190-96735212 GATGGGATATCGGCGTTGAGTGG - Intergenic
1073014151 10:100384710-100384732 GATGGGATATTGGCATTGAGTGG - Intergenic
1074019158 10:109565333-109565355 GATGGGATATTGGCGTTGAGCGG - Intergenic
1074740912 10:116483624-116483646 GATGGGATATTGGAGTTGAGCGG - Intergenic
1075013960 10:118896516-118896538 GATGGGATATTGGCATTGAGTGG - Intergenic
1075146099 10:119884381-119884403 GTTGGGACCCTGGAGCTGAGTGG - Intronic
1075307838 10:121383614-121383636 GATGGGACTATGTAGTTGCAGGG - Intergenic
1075499014 10:122954790-122954812 GATGGGGTTTTGGGGTTGAAGGG + Intronic
1077168289 11:1153449-1153471 GATGGGGGTTGGGAGCTGAGGGG + Intergenic
1077850665 11:6072571-6072593 GATGGGATATTGGTGTTGAGCGG + Intergenic
1078045999 11:7914899-7914921 GATGGGATATTGGTGTTGAGTGG + Intergenic
1078518761 11:12047100-12047122 GAAAGGACTTTGCAGTGGAGGGG - Intergenic
1078789123 11:14525433-14525455 GATGGGATATTGGCGTTGAGCGG - Intronic
1079447598 11:20570765-20570787 GATGGGATATTGGCATTGAGTGG - Intergenic
1079726954 11:23889925-23889947 GATGGGATATTGGCATTGAGCGG + Intergenic
1080027778 11:27631818-27631840 GATGGGATATTGGCGTTGAGTGG + Intergenic
1080174583 11:29346795-29346817 GAGACGACTTTGGAGTTGATAGG + Intergenic
1080227497 11:29976374-29976396 GATGGGATACTGGCGTTGAGCGG - Intergenic
1080568717 11:33536423-33536445 GCTGGGACTGTGGATTGGAGTGG + Intergenic
1081159833 11:39737375-39737397 GATGGGATATTGGCATTGAGTGG - Intergenic
1081356947 11:42123553-42123575 GATGGGATATTGGCGTTGAGCGG - Intergenic
1082100247 11:48167094-48167116 GATGGGGTTTGGGAGTTGGGCGG + Intronic
1082197637 11:49324172-49324194 GATGGGATATTGGTGTTGAGCGG + Intergenic
1082626723 11:55495844-55495866 TATTGGATTTTGGAGTTGAATGG - Intergenic
1084047295 11:66576590-66576612 GATGGGATCTTGGCATTGAGCGG - Intergenic
1084232434 11:67762650-67762672 GATGGGATATTGGCGTTGAGTGG - Intergenic
1084354331 11:68627114-68627136 GATGGGATATTGGCGTTGAGCGG - Intergenic
1084952590 11:72674840-72674862 GATGGGGCTGGGGACTTGAGGGG + Intergenic
1085570325 11:77552905-77552927 GATGGGATATTGGCATTGAGTGG - Intronic
1085728212 11:78973950-78973972 GCAGGGACTTTGCAGTTGTGGGG - Intronic
1085988142 11:81809185-81809207 GATGGGATATTGGCATTGAGCGG - Intergenic
1086041171 11:82481220-82481242 GTTGGGGGTTGGGAGTTGAGGGG - Intergenic
1086136132 11:83445636-83445658 GATGGGATATTGGCGTTGAGTGG + Intergenic
1086550344 11:88046159-88046181 GATGGGATATTGGCCTTGAGTGG - Intergenic
1086658188 11:89383955-89383977 GATGGGATATTGGTGTTGAGTGG - Intronic
1087127943 11:94644580-94644602 GATGGGATATTGGCATTGAGCGG - Intergenic
1087167945 11:95023234-95023256 GATGGGATATTGGCATTGAGCGG + Intergenic
1087314812 11:96590901-96590923 GATGGGATATTGGCGTTGAGTGG - Intergenic
1087868105 11:103258511-103258533 GAGAGGACTTGAGAGTTGAGGGG + Intronic
1087926916 11:103929433-103929455 GAGGGCACTTTGGAGTTTATTGG - Intronic
1088555085 11:111053161-111053183 GATGGGATATTGGCGTTGAGCGG - Intergenic
1088926511 11:114308329-114308351 GATGGGGCTTTGGGGATGTGAGG + Intronic
1089349218 11:117812243-117812265 GATGGGATATTGGCATTGAGTGG - Intronic
1089866921 11:121640663-121640685 GATGGGATATTGGCGTTGAGCGG + Intergenic
1089953442 11:122549923-122549945 GATGAGACATTGGCATTGAGCGG - Intergenic
1090107465 11:123868327-123868349 GATGGGATATTGGCATTGAGCGG + Intergenic
1090546367 11:127771812-127771834 GATGGGATATTGGCATTGAGTGG + Intergenic
1090632889 11:128665865-128665887 GATGGGAACTGGGAGTTGAAAGG - Intergenic
1090756253 11:129794464-129794486 GATAAGACTTTGGACTTGTGGGG - Intergenic
1090850463 11:130567099-130567121 GATAGGATATTGGCGTTGAGTGG + Intergenic
1090871827 11:130756252-130756274 GATGGGATATTGGCGTTGAGCGG + Intergenic
1091183812 11:133629766-133629788 GATGGGATATTGGCGTTGAGCGG - Intergenic
1091253394 11:134163052-134163074 GATGGCAATTTGAAGTGGAGAGG + Intronic
1092474620 12:8807896-8807918 GATGGGATATTGGCGTTGAGCGG - Intergenic
1092626616 12:10335663-10335685 GATGGGATATTGGCGTTGAGTGG + Intergenic
1092789835 12:12061360-12061382 GATGGGATCTTGGCATTGAGCGG - Intronic
1092924721 12:13262708-13262730 GATGGGATATTGGCATTGAGTGG + Intergenic
1093024469 12:14233548-14233570 GATGGGATATTGGCATTGAGTGG - Intergenic
1093070097 12:14699502-14699524 GATGGGACTTGGTATTTGACTGG + Intergenic
1093071030 12:14707608-14707630 GATGGGATATTGGCGTTGAGTGG + Intergenic
1093236015 12:16609300-16609322 GGTGAGACTTTGGGGTTGGGGGG - Intronic
1093358563 12:18197926-18197948 AATGGGATATTGGCGTTGAGTGG - Intronic
1093578951 12:20766343-20766365 GATGGGATATTGGCGTTGAGTGG - Intergenic
1093812705 12:23508753-23508775 GATGGGATATTGGCATTGAGCGG + Intergenic
1093951202 12:25166120-25166142 GATGGGATATTGGCATTGAGCGG - Intronic
1094286441 12:28799370-28799392 GATGTGTCTTGGGAGTGGAGCGG + Intergenic
1094400813 12:30058954-30058976 GATGGGATATTGGCATTGAGCGG - Intergenic
1095637781 12:44452769-44452791 GATGGGATATTGGCGTTGAGCGG - Intergenic
1095778259 12:46032789-46032811 GATGGGATATTGGCGTTGAGTGG - Intergenic
1095998893 12:48112870-48112892 GATGGGATATTGGCATTGAGTGG + Intronic
1097398718 12:59104808-59104830 GATGGGATATTGGCATTGAGTGG - Intergenic
1097416920 12:59325955-59325977 GATGGGATTTTGGCATTGAGTGG + Intergenic
1097445398 12:59666054-59666076 AATTGGAGTTTGGAGTTGATAGG + Intronic
1098173503 12:67769383-67769405 GATGGGATATTGGCGTTGAGTGG + Intergenic
1098629196 12:72706327-72706349 GATGGGATATTGGCATTGAGTGG - Intergenic
1098653700 12:73004752-73004774 GATGGGATATTGGTATTGAGGGG + Intergenic
1098920037 12:76294433-76294455 GATGGGATATTGGCGTTGAGCGG - Intergenic
1099188852 12:79542838-79542860 GATGGGATATTGGTGTTGAGTGG - Intergenic
1099229090 12:80002353-80002375 CATGAGATTTGGGAGTTGAGAGG - Intergenic
1099291969 12:80785818-80785840 GATGGGATATTGGCATTGAGCGG + Intergenic
1099762721 12:86941776-86941798 GATGGGATATTGGCGTTGAGTGG - Intergenic
1099835965 12:87910130-87910152 GATGGGATATTGGCATTGAGCGG + Intergenic
1100561494 12:95752137-95752159 GATGGGATATTGGCGTTGAGTGG - Intronic
1102575758 12:113855188-113855210 GCAGGGACTGTGGTGTTGAGGGG + Intronic
1103333027 12:120168003-120168025 AATGGGACTTGGGAGATGTGTGG - Intronic
1105032358 12:132892686-132892708 GATGGGATATTGGCATTGAGCGG - Intronic
1105940125 13:25140561-25140583 GCTGGGACCTTGGAGTAGAGAGG + Intergenic
1106943575 13:34801611-34801633 GATGGGATATTGGCGTTGAGTGG - Intergenic
1107075720 13:36319418-36319440 GATGGGATATTGGCGTTGAGTGG - Intronic
1107220164 13:37971911-37971933 GATGGGATATTGGCATTGAGTGG + Intergenic
1107683006 13:42870153-42870175 GATGGGATATTGGTGTTGAGTGG + Intergenic
1108019692 13:46114402-46114424 GATGGGACTTTGTGATTGACTGG + Intergenic
1108202827 13:48059369-48059391 GATGGGATATTGGCATTGAGCGG - Intronic
1108513129 13:51172841-51172863 GATGGGATATTGGCGTTGAGTGG - Intergenic
1108803737 13:54130424-54130446 GATGGGATATTGGCCTTGAGCGG + Intergenic
1108814262 13:54269834-54269856 GATGGGATATTGGCGTTGAGTGG - Intergenic
1108872689 13:55005932-55005954 TGTGGAACTTTGAAGTTGAGAGG - Intergenic
1108913284 13:55580979-55581001 GATGGGATATTGGCGTTGAGTGG + Intergenic
1108919417 13:55657709-55657731 GATGGGATATTGGCATTGAGTGG + Intergenic
1108947568 13:56043282-56043304 GATGGGATATTGGCGTTTAGCGG - Intergenic
1109353045 13:61207777-61207799 TATGGGATATTGGCGTTGAGCGG - Intergenic
1109499426 13:63216088-63216110 GATGGGATATTGGCATTGAGCGG - Intergenic
1109695096 13:65944807-65944829 GGTGGGACTGTGGAATTGGGGGG + Intergenic
1109709528 13:66144068-66144090 GATGGGATATTGGCGTTGAGTGG + Intergenic
1109716609 13:66229119-66229141 GATGGGATATTGGCATTGAGTGG + Intergenic
1110650360 13:77936063-77936085 GATGGGATATTGGCATTGAGCGG + Intergenic
1110845470 13:80186645-80186667 GATGGGATATTGGTGTTGAGTGG - Intergenic
1110978616 13:81869154-81869176 GATGGGATATTGGCGTTGAGTGG - Intergenic
1111302175 13:86361377-86361399 GATGGGATATTGGCGTTGAGTGG - Intergenic
1111458707 13:88515568-88515590 GATGGGATATTGGCGTTGAGTGG + Intergenic
1111631570 13:90851325-90851347 GATGGGATATTGGGGTTGAGTGG + Intergenic
1112236960 13:97645289-97645311 GATGGGATCTTGGCATTGAGTGG - Intergenic
1113719289 13:112541127-112541149 GATGGGACTGGAGAGTTGATAGG - Intronic
1113785794 13:113001557-113001579 GATGGGACTTTGGCGGAGTGTGG + Intronic
1114440511 14:22742832-22742854 GATGGGACTGAGAAGCTGAGAGG + Intergenic
1114770923 14:25428434-25428456 GATGGGATATTGGCATTGAGTGG + Intergenic
1115240475 14:31248133-31248155 GATGGGATATTGGCGTTGAGCGG + Intergenic
1115439597 14:33417639-33417661 GGTGGGACTTTAGAGCAGAGAGG - Intronic
1115453450 14:33574826-33574848 GAATGGACTTTGGAGGTGGGAGG + Intronic
1115741705 14:36395652-36395674 GATGTGAATTGGGAGTGGAGTGG - Intergenic
1115904942 14:38193769-38193791 GATGGGATATTGGCATTGAGTGG - Intergenic
1116490447 14:45498119-45498141 GATGGGATATTGGCATTGAGTGG + Intergenic
1116573582 14:46546892-46546914 GATGGGATATTGGCATTGAGCGG - Intergenic
1116613648 14:47107159-47107181 GATGGGATATTGGCCTTGAGTGG - Intronic
1116703159 14:48265102-48265124 GATGGGATCTTGGCATTGAGCGG + Intergenic
1116953049 14:50896149-50896171 GACGGGATATTGGCGTTGAGTGG - Intronic
1118937122 14:70298536-70298558 GATGGGATACTGGCGTTGAGCGG + Intergenic
1119022553 14:71127298-71127320 GATGGGATATTGGCATTGAGCGG - Intergenic
1119560141 14:75583412-75583434 GATGGGATATTGGTGTTGAGTGG + Intronic
1119623514 14:76151574-76151596 AATGGGTCTGTGAAGTTGAGGGG - Intergenic
1120251267 14:82063821-82063843 GATGGGATATTGGCATTGAGCGG + Intergenic
1121806288 14:96827218-96827240 GGGGTGAATTTGGAGTTGAGAGG - Intronic
1122041130 14:98988173-98988195 GATGGGATATTGGCATTGAGTGG - Intergenic
1122318879 14:100841455-100841477 GCTGGGTCTTTGGAGTTGTTGGG + Intergenic
1122507762 14:102242585-102242607 GATGGGATATTGGCGTTGAGTGG - Intronic
1123882366 15:24688316-24688338 GATGGGATATTGGCATTGAGTGG + Intergenic
1124562583 15:30788914-30788936 AATGTGACTTTGGAGTTTGGAGG - Intergenic
1125131381 15:36288375-36288397 GATGGGATATTGGCATTGAGTGG + Intergenic
1125213085 15:37238950-37238972 GATGGGATATTGGCATTGAGCGG + Intergenic
1125629357 15:41134486-41134508 GATGGGATATTGGCGTTGAAGGG - Intergenic
1125849213 15:42887448-42887470 GATGGGATATTGGCGTTGAGCGG - Intronic
1126530019 15:49701875-49701897 GATGGGATATTGGCATTGAGCGG + Intergenic
1126843881 15:52741555-52741577 GATGGGATATTGGCGTTGAGCGG - Intergenic
1129404532 15:75306992-75307014 CATGGTAATTTGGAGTTGAATGG + Intergenic
1129754821 15:78091708-78091730 GAGGGGACTTTGGAGTAGATGGG - Intronic
1130358787 15:83160644-83160666 GAGAGGACTCTGGAGTAGAGGGG + Intronic
1130853591 15:87821363-87821385 AATGGGACTTTGGAGGTGCAAGG - Intergenic
1130855238 15:87834243-87834265 GATGGGATATTGGCGTTGAGTGG - Intergenic
1131095534 15:89652388-89652410 GAAGGGTCGTTGGAGGTGAGTGG - Intronic
1131426465 15:92349190-92349212 GATGGCACTTGGGAGTTTTGGGG - Intergenic
1131447878 15:92514484-92514506 GATGGGATATTGGCATTGAGCGG - Intergenic
1131684309 15:94753747-94753769 GATGGGATATTGGCATTGAGCGG - Intergenic
1131684835 15:94757446-94757468 GATGGGATATTGGCATTGAGCGG - Intergenic
1131846809 15:96497111-96497133 GAGGAGACATTGGAGTTGAGGGG + Intergenic
1131903250 15:97112318-97112340 GTTGGGAGGTTGGAGGTGAGGGG + Intergenic
1132263149 15:100443265-100443287 GATGGGATATTGGCGTTGAGCGG - Intronic
1132340550 15:101075514-101075536 GATGGGATATTGGTGTTGAGCGG - Intronic
1133651528 16:7817672-7817694 GATGGGATCTTGGCATTGAGCGG - Intergenic
1133766625 16:8842827-8842849 GATGGGATATTGGCGTTGAGCGG + Intronic
1133938303 16:10286133-10286155 GATGGGACATTGGTGTTGAGTGG - Intergenic
1134342043 16:13355302-13355324 GATGGGATATTGGCGTTGAGTGG + Intergenic
1134639933 16:15822204-15822226 GATCTGAGTTGGGAGTTGAGAGG - Intronic
1135025276 16:18994871-18994893 GATGGGATATTGGCATTGAGCGG + Intronic
1135153064 16:20026826-20026848 AAAGTGACTTAGGAGTTGAGGGG - Intergenic
1135643118 16:24138188-24138210 AAGGGGACTATGGAGCTGAGTGG - Intronic
1137229165 16:46546298-46546320 GTTGGGACCTTGGATTTGGGAGG + Intergenic
1138089905 16:54165509-54165531 GCTGGGCCTCTGCAGTTGAGTGG - Intergenic
1138526941 16:57614330-57614352 TGTGGGACTTTGGGGTTCAGGGG + Intronic
1138650033 16:58454865-58454887 GGTGGGGCTTTGGGGTTGTGAGG - Intergenic
1138758967 16:59520373-59520395 GATGGGATATTGGCATTGAGGGG + Intergenic
1138805086 16:60081806-60081828 GATGGGATATTGGCATTGAGTGG - Intergenic
1139039105 16:62981881-62981903 GATGGGATATTGGCATTGAGTGG + Intergenic
1139225781 16:65232566-65232588 GATGGGATATTGGCGTTGAGTGG + Intergenic
1139942920 16:70619205-70619227 GATGGGATATTGGCGTTGAGTGG + Intronic
1140208171 16:72950326-72950348 GTTGGGAACCTGGAGTTGAGAGG - Intronic
1141796669 16:86279512-86279534 GATGGGATACTGGCGTTGAGTGG - Intergenic
1141865072 16:86744768-86744790 GATGGGATATTGGCATTGAGCGG + Intergenic
1143075406 17:4338476-4338498 GACTGGTATTTGGAGTTGAGGGG - Intronic
1143462567 17:7113198-7113220 GAAGGGTCTTGGGAGATGAGAGG + Intronic
1144104801 17:11974863-11974885 GATGGGATATTGGCATTGAGCGG - Intergenic
1144423933 17:15123530-15123552 GATGTGACATTGGAGATGAAGGG + Intergenic
1144807841 17:17979349-17979371 GATGGGACTTAGGATTTCACAGG + Intronic
1145080533 17:19891200-19891222 GATGGGATATTGGCGTTGATTGG + Intergenic
1146598037 17:34186253-34186275 GATTGGATATTGGCGTTGAGTGG - Intergenic
1147440568 17:40444584-40444606 AGAGGGACTTTGGCGTTGAGGGG + Intronic
1150807114 17:68328143-68328165 GATGGAACTCTGGGGGTGAGTGG - Intronic
1151446047 17:74164765-74164787 GATGGGACTTTAGGGTTTGGTGG - Intergenic
1151502923 17:74503734-74503756 GATGGGATACTGGTGTTGAGCGG - Intergenic
1151622618 17:75255547-75255569 GATGGGATATTGGCATTGAGCGG - Intronic
1151810340 17:76436635-76436657 GATAGCACTTTTGAGTAGAGAGG - Intronic
1151839616 17:76608691-76608713 GATGGGATATTGGCATTGAGTGG + Intergenic
1152454095 17:80402875-80402897 GATGGGATATTGGCATTGAGTGG - Intergenic
1155173956 18:23287029-23287051 GATGGGATATTGGTATTGAGCGG - Intronic
1155696889 18:28695849-28695871 GATGGGATATTGGCATTGAGTGG + Intergenic
1155892575 18:31286971-31286993 GATGGGATATTGGTGTTGAGTGG + Intergenic
1155941679 18:31806775-31806797 GATGGGATATTGGCGTTGAGCGG - Intergenic
1155962135 18:32003581-32003603 GATGGGATATTGGCGTTGATTGG - Intergenic
1156237493 18:35218743-35218765 GATGGGATATTGGCATTGAGTGG - Intergenic
1156302381 18:35846899-35846921 GATGGGATATTGGCATTGAGTGG - Intergenic
1156938660 18:42739625-42739647 GATGGGATATTGGCATTGAGGGG - Intergenic
1156958314 18:42993852-42993874 GATGGGATATTGGCGTTGAGTGG - Intronic
1157126618 18:44962323-44962345 GATGGAAGTTAGCAGTTGAGTGG + Intronic
1157718841 18:49907926-49907948 GATGGGACTTGGGAGCTTTGAGG + Intronic
1157906262 18:51572769-51572791 GATGGGATATTGGCGTTGATCGG + Intergenic
1158336510 18:56418569-56418591 GATGGGATATTGGCGTTGAGTGG - Intergenic
1159016495 18:63105273-63105295 GACGGGAGTGTGGTGTTGAGTGG + Intergenic
1159164605 18:64684603-64684625 GATGGGATATTGGCATTGAGTGG - Intergenic
1159835187 18:73327615-73327637 GATGGGATATTGGCATTGAGTGG - Intergenic
1161345910 19:3768610-3768632 TAGGGGACTCTGGAGTGGAGGGG + Intergenic
1161661861 19:5551450-5551472 GATGGGATATTGGCGTTGAGCGG - Intergenic
1162220089 19:9168881-9168903 GTTTGGAGTTTGGAGTAGAGAGG + Intergenic
1162558278 19:11401131-11401153 GATGGGACAGTTGAGTTGAATGG + Intronic
1162721175 19:12663879-12663901 GAGGGGAGTTTGGTGGTGAGAGG - Intronic
1163558739 19:18006917-18006939 GATGGGTCTTTGGAGTTGAAAGG - Intronic
1164153109 19:22571219-22571241 GATGGGATATTGGCGTTGAGTGG - Intergenic
1165223499 19:34337445-34337467 GATGTGACATTGGATTTGAGAGG + Intronic
1165249373 19:34516959-34516981 GATGGGATATTGGCATTGAGTGG - Intergenic
1165690359 19:37858244-37858266 TATATGACTCTGGAGTTGAGGGG - Intergenic
1165835490 19:38752585-38752607 GATGGGATATTGGCATTGAGCGG - Intronic
1165858721 19:38895296-38895318 GAAGGGCCTTTGAAGTGGAGAGG - Intronic
1165924471 19:39318702-39318724 TTCAGGACTTTGGAGTTGAGGGG - Intergenic
1166303941 19:41927460-41927482 CATAGGAGTTTGGACTTGAGGGG - Intronic
1166498806 19:43326242-43326264 GATGGGATATTGGCGTTGAGTGG + Intergenic
1167099591 19:47396017-47396039 GATGGGATATTGGCGTTGAGCGG - Intergenic
1167902281 19:52630746-52630768 GATGGGATACTGGCGTTGAGTGG - Intronic
1168051772 19:53834577-53834599 AATGGGATATTGGCGTTGAGTGG - Intergenic
1168211994 19:54897619-54897641 GATGGGATATTGGCATTGAGCGG + Intergenic
1168248288 19:55125515-55125537 GATGGGATATTGGTGTTGAGTGG - Intergenic
925433730 2:3818643-3818665 GATGGGATATTGGTGTTCAGTGG + Intronic
925544686 2:5003957-5003979 GATGGGATATTGGCATTGAGTGG - Intergenic
925828691 2:7875410-7875432 GATGGGATATTGGCGTTGAGTGG + Intergenic
926413723 2:12629477-12629499 GATGGGATATTGGCATTGAGTGG - Intergenic
926815411 2:16794672-16794694 GATGGGATATTGGTGTTGAGCGG + Intergenic
927134286 2:20085290-20085312 GATGGGATATTGGCATTGAGCGG - Intergenic
928770691 2:34699827-34699849 GATGGGATATTGGCATTGAGCGG + Intergenic
928778436 2:34792681-34792703 GATGGGATATTGGCATTGAGCGG - Intergenic
928928699 2:36602011-36602033 GATGGGATATTGGCGTTGAGTGG - Intronic
929004714 2:37383734-37383756 GATGGGATATTGGTGTTGAGCGG + Intergenic
929684392 2:44021779-44021801 GATGGGATATTGGCATTGAGTGG + Intergenic
929855163 2:45631352-45631374 GATGGGGGGTTGGAGTTGGGGGG - Intergenic
930487231 2:52024843-52024865 GATGGGATATTGGCATTGAGTGG + Intergenic
931026262 2:58116156-58116178 GATGGGATATTGGCATTGAGTGG + Intronic
931237068 2:60420579-60420601 GATAGGATATTGGCGTTGAGTGG - Intergenic
931608808 2:64077916-64077938 GATGGCATATTGGCGTTGAGTGG + Intergenic
931625913 2:64255508-64255530 GATGGGATATTGGCGTTGAGTGG - Intergenic
931801247 2:65760290-65760312 CATTGGCCTTTGGAGTTGGGTGG - Intergenic
931850549 2:66246901-66246923 GATGGGATATTGGCGTTGAGTGG - Intergenic
931948386 2:67334576-67334598 GATGGGATATTGGCATTGAGCGG - Intergenic
932159319 2:69446388-69446410 GATGGGATATTGGCGTTGAGCGG + Intergenic
932295977 2:70623606-70623628 GATGGGATATTGGCATTGAGTGG - Intronic
932330017 2:70893385-70893407 GAGGGGCCTTTTGAATTGAGGGG - Intergenic
932333228 2:70912733-70912755 GATAGGGCTTTGGAGGTGGGGGG + Intronic
932344793 2:70988463-70988485 GATGGGGCTCCAGAGTTGAGGGG + Exonic
932358686 2:71087778-71087800 GATGGGATATTGGCATTGAGCGG + Intergenic
932367513 2:71162421-71162443 GATGGGATATTGGCATTGAGTGG + Intergenic
932854078 2:75216508-75216530 GATGGCATATTGGCGTTGAGTGG + Intergenic
933013222 2:77091346-77091368 GATGGGATATTGGCGTTGAGTGG - Intronic
933079400 2:77968079-77968101 GATGGGATATTGGCGTTGAGTGG - Intergenic
933179635 2:79214552-79214574 GATGGGATATTGGCATTGAGCGG + Intronic
933329382 2:80877202-80877224 GATGGGATATTGGCGTTGAGTGG + Intergenic
933552263 2:83791641-83791663 GATGGGAGATTGGCATTGAGTGG + Intergenic
936794161 2:116187001-116187023 GATGGGATATTGGCTTTGAGCGG + Intergenic
936883465 2:117281711-117281733 GATGGGATATTGGCATTGAGTGG - Intergenic
937370089 2:121291255-121291277 GATGGGAGAATGGATTTGAGGGG + Intergenic
937504962 2:122526573-122526595 GATGGCACCTTGGAGTGGGGTGG - Intergenic
938069356 2:128300322-128300344 GATGGGACACTGGAGAAGAGGGG + Intronic
939498357 2:142949987-142950009 TATGGAACTTTGAACTTGAGAGG - Intronic
940183081 2:150956019-150956041 GATGGGATATTGGCATTGAGTGG - Intergenic
940216955 2:151311804-151311826 GATGGGATATTGGCATTGAGTGG - Intergenic
940295563 2:152120464-152120486 CATGGTCCTTTTGAGTTGAGAGG + Exonic
940530312 2:154870290-154870312 GATGGGATATTGGCATTGAGCGG - Intergenic
940675675 2:156722800-156722822 GATGGGATATTGGCATTGAGCGG + Intergenic
941340522 2:164298822-164298844 GATGGGATATTGGCATTGAGTGG - Intergenic
941548633 2:166886410-166886432 AATGAGTCTTTGGAGATGAGAGG + Intergenic
941699750 2:168592062-168592084 GATGGAACTTTGGATTTAGGAGG + Intronic
941935767 2:170980376-170980398 GATGGGATATTGGCATTGAGTGG + Intergenic
942730160 2:179054492-179054514 GATGGGATATTGGCATTGAGCGG + Intergenic
942826037 2:180178063-180178085 GATTGGACCTTGCAGTTGACTGG - Intergenic
942865621 2:180670865-180670887 CATGGGACTCTGGAGCTGAGAGG - Intergenic
943412799 2:187563221-187563243 GATGGGATATTGGCATTGAGTGG + Intronic
943450259 2:188036183-188036205 GATGGGATATTGGCATTGAGGGG - Intergenic
943461069 2:188171939-188171961 GATGGGATATTGGCATTGAGCGG + Intergenic
943806772 2:192133389-192133411 GATGGGATATTGGCATTGAGTGG - Intronic
943835524 2:192510449-192510471 GATGGGATATTGGCATTGAGCGG - Intergenic
943865467 2:192921034-192921056 GATGGGATATTGGCATTGAGTGG - Intergenic
944394270 2:199249905-199249927 GATGGGATATTGGCATTGAGTGG - Intergenic
945301355 2:208218971-208218993 GATGGGATATTGGCGTTGAGTGG + Intergenic
945376237 2:209081047-209081069 GATGGGATATTGACGTTGAGTGG - Intergenic
945795587 2:214358735-214358757 AATGGGAGTTGGGGGTTGAGGGG + Intronic
945938456 2:215925351-215925373 GATGGGATATTGGCGTTGAGTGG - Intergenic
946214906 2:218176772-218176794 GATGGGATCTTGGCATTGAGTGG + Intergenic
946372872 2:219291065-219291087 GCTGGGACTTGGGCCTTGAGAGG + Intronic
946632784 2:221689333-221689355 GATGGGACTTTGGACAGGACGGG + Intergenic
946664579 2:222035523-222035545 GATGGGATTCTGGGGTTGTGGGG - Intergenic
946780913 2:223192571-223192593 GATGGGATATTGGCATTGAGTGG + Intronic
946871633 2:224090583-224090605 GATGGGATATTGGCGTTGAGCGG + Intergenic
947876914 2:233473789-233473811 GACGGGACAGTAGAGTTGAGTGG + Intergenic
1169024505 20:2357584-2357606 GATTGGATGTGGGAGTTGAGGGG + Intergenic
1169647871 20:7833778-7833800 GTTGGGACTCTGGAGCTGAATGG + Intergenic
1170024532 20:11874418-11874440 GAAGGCACTTTGGAGCTGAAAGG - Intergenic
1170165876 20:13359936-13359958 GATGGGATATTGGCATTGAGTGG - Intergenic
1170184332 20:13571453-13571475 AATGGGACTTTGAAGTAGATTGG - Intronic
1170680306 20:18520334-18520356 GATGGGATATTGGCATTGAGCGG + Intronic
1170820572 20:19753886-19753908 GATAGGATATTGGCGTTGAGCGG + Intergenic
1172311640 20:33922773-33922795 GATGGTAGTTTGGAATAGAGTGG + Intergenic
1172318972 20:33981257-33981279 TTTGGTACTTTGGAGTTGAAGGG - Intergenic
1172932335 20:38595447-38595469 GATGGGATATTGGCGTTGAGCGG + Intergenic
1173102040 20:40096305-40096327 GATGGGATATTGGTGTTGAGTGG - Intergenic
1173119001 20:40272025-40272047 GATGGGATATTGGCATTGAGTGG - Intergenic
1174058296 20:47814891-47814913 CATTGGACTTGGGAGTTGGGAGG + Intergenic
1175337997 20:58208925-58208947 GATGGGACTGTGTAGTTGCAGGG - Intergenic
1175655765 20:60769036-60769058 CATGGAATTTTGGAGTTCAGAGG - Intergenic
1176034062 20:63027963-63027985 GCTGGGACCTTGGAGAGGAGGGG - Intergenic
1177031043 21:15982528-15982550 GATGGGATATTGGTATTGAGTGG + Intergenic
1177119698 21:17124468-17124490 GATGGGATATTGGCATTGAGTGG - Intergenic
1178001322 21:28164179-28164201 GATGGGATATTGGTATTGAGTGG - Intergenic
1179138405 21:38700586-38700608 CAGGGGAGTTTGGAGTGGAGTGG - Intergenic
1179174116 21:38995063-38995085 GATGAGGCCTTGGAGTTAAGAGG + Intergenic
1179387692 21:40957925-40957947 GATGGGATATTGGCATTGAGTGG - Intergenic
1181165934 22:20982904-20982926 GATGGATCTTAGCAGTTGAGAGG + Intronic
1182732408 22:32505747-32505769 GATGGGATATTGGCGTTGAGTGG - Intergenic
1184512325 22:44940892-44940914 GGTGGGGCTGTGGAGGTGAGTGG + Intronic
949161960 3:893403-893425 GATGGGATATTGGCGTTGAGTGG + Intergenic
949190260 3:1242542-1242564 GATGGGATATGGGCGTTGAGCGG + Intronic
949374220 3:3369065-3369087 GATGAGAGTTTGGTGTGGAGAGG - Intergenic
949671288 3:6400654-6400676 GATGGGATCTTGGCATTGAGCGG - Intergenic
949827575 3:8179985-8180007 GATGGGATATTGGCATTGAGCGG - Intergenic
949973878 3:9436228-9436250 GACTGTACTTTGGGGTTGAGAGG - Intronic
950036674 3:9890918-9890940 GAGGGGACTTGGCAGGTGAGCGG - Intronic
950635048 3:14308401-14308423 GATGGGTGTTTGGAGTTCTGGGG - Intergenic
951298690 3:20970243-20970265 GATGGGATATTGGCATTGAGTGG + Intergenic
951634520 3:24758097-24758119 GATTATACTTTGGAGTTGCGTGG - Intergenic
951762665 3:26163107-26163129 GATGGGATATTGGCATTGAGTGG + Intergenic
952343442 3:32464153-32464175 GATGGGATATTGGCATTGAGCGG + Intronic
952895087 3:38073402-38073424 GATGGGATATTGGCATTGAGTGG + Intronic
952895919 3:38079011-38079033 GATGGGATATTGGCATTGAGCGG + Intronic
952941208 3:38445617-38445639 GTTGGGACCTTGGAGCTGAATGG + Intergenic
953076992 3:39580534-39580556 GATTGGATATTGGTGTTGAGCGG + Intergenic
953149755 3:40314128-40314150 GATTGGACTTTGAACTTGTGGGG + Intergenic
953177336 3:40563952-40563974 GATGGGATATTGGCATTGAGCGG - Intronic
953546032 3:43864137-43864159 GCTGGGATTTTGGAGTTGGAAGG + Intergenic
953670392 3:44957497-44957519 GATGGGAGTTTGATGATGAGGGG - Intronic
953777742 3:45836948-45836970 GAAGGGACTTTGGAGGGTAGAGG - Intronic
953841049 3:46390505-46390527 GATGGGATATTGGCATTGAGCGG + Intergenic
954161637 3:48727060-48727082 GATGGGATATTGGCATTGAGTGG + Intronic
954943035 3:54392661-54392683 GTGGGGGCTTTGGAGTGGAGGGG + Intronic
955015418 3:55064732-55064754 GATGGGAGGATGGATTTGAGAGG + Intronic
955741005 3:62091792-62091814 GAGGGGAGGTGGGAGTTGAGTGG + Intronic
956899210 3:73696738-73696760 GTATGGACTTTGGAGATGAGTGG - Intergenic
957295365 3:78326781-78326803 GATGGGATATTGGCATTGAGTGG - Intergenic
957317173 3:78585879-78585901 GATGGGATATTGGCGTTGAGTGG + Intergenic
957333316 3:78794424-78794446 TATGGGACCTTGGAGTTGGAAGG + Intronic
957394503 3:79620783-79620805 AATGGGATATTGGTGTTGAGTGG - Intronic
957451566 3:80387855-80387877 GATGGGATACTGGTGTTGAGTGG - Intergenic
957909436 3:86603183-86603205 TATGGAACTTTGAATTTGAGAGG + Intergenic
958183017 3:90084038-90084060 GATGGGATATTGGCATTGAGCGG - Intergenic
958751114 3:98193910-98193932 GATGGGATATTGGCATTGAGTGG - Intronic
959288220 3:104442649-104442671 GATGGGATATTGGCGTTGAGTGG + Intergenic
959972130 3:112420296-112420318 GATGGGATATTGGCGTTGAGTGG + Intergenic
960282741 3:115796235-115796257 GATGGGATATTGGCGTTGAGTGG + Intergenic
960309993 3:116108053-116108075 GATGGGATATTGGCATTGAGCGG + Intronic
961164632 3:124755293-124755315 GATGGGATATTGGCGTTGAGCGG + Intergenic
961293621 3:125866626-125866648 GATGGGATATTGGCATTGAGCGG - Intergenic
961711494 3:128831929-128831951 GATGGGATATTGGCATTGAGCGG + Intergenic
961712575 3:128838915-128838937 GATGGGATATTGGCATTGAGCGG + Intergenic
961881173 3:130062241-130062263 GATGGGATATTGGCATTGAGTGG - Intergenic
962205702 3:133432092-133432114 GATGGGACATTGGCGTTGAGAGG - Intronic
962522932 3:136213734-136213756 CATGGGACTGTGCAGTGGAGTGG - Intergenic
962660766 3:137598452-137598474 GATGGGATATTGGCGTTGAGCGG - Intergenic
963058757 3:141207944-141207966 GATGGGATATTGGCATTGAGTGG - Intergenic
963111712 3:141694031-141694053 GATGGGATATTGGCGTTGAGTGG + Intergenic
963456534 3:145553920-145553942 GATGGGATATTGGCATTGAGTGG + Intergenic
963468734 3:145713372-145713394 GATGGGATATTGGCATTGAGGGG - Intergenic
963521743 3:146365032-146365054 GATGGGATATTGGCATTGAGTGG - Intergenic
963684466 3:148417323-148417345 GATGGGATATTGGCATTGAGTGG - Intergenic
964068023 3:152600421-152600443 GATGGGATCTTGGCATTGAGTGG - Intergenic
964110937 3:153086825-153086847 CCTGGGACTTTGGAGTTTGGAGG - Intergenic
964125324 3:153229424-153229446 GATTGGATATTGGCGTTGAGTGG + Intergenic
964175904 3:153826013-153826035 GATGGGATATTGGCATTGAGTGG + Intergenic
964940832 3:162156868-162156890 GATGGGATATTGGCATTGAGTGG + Intergenic
964983748 3:162715370-162715392 GATGGGATATTGGCGTTGAGTGG - Intergenic
965109537 3:164402601-164402623 GAAGGGAGTTTGGTGTAGAGGGG + Intergenic
965152560 3:164998048-164998070 AATGGGATTTTGGGGTTGAATGG + Intronic
965335231 3:167425571-167425593 GATGGGATATTGGTGTTGAGTGG - Intergenic
965626193 3:170686065-170686087 GATGGGATATTGGCATTGAGGGG + Intronic
965639908 3:170820698-170820720 GATGGGATATTGGTGTTGAGCGG + Intronic
965713548 3:171579393-171579415 GATGGGATATTGGCGTTGAGTGG - Intergenic
966066959 3:175830680-175830702 GATGGGATCTTGGCATTGAGCGG - Intergenic
966308184 3:178561568-178561590 GATGGGATTTTAGAGTTGGAAGG - Intronic
967212033 3:187178264-187178286 GATGGGATATTGGCATTGAGGGG + Intronic
967496353 3:190147476-190147498 GATGGGATATTGGCATTGAGTGG - Intergenic
967561516 3:190923084-190923106 GATGGGATATTGGTGTTGAGTGG - Intergenic
967624518 3:191669219-191669241 GATGGGATATTGGCGTTGAGTGG + Intergenic
967657976 3:192073821-192073843 GATGGAATATTGGGGTTGAGCGG + Intergenic
967734921 3:192941948-192941970 TATGGGAGTTTGGAGTTGGAGGG + Intergenic
968413068 4:405946-405968 GATGGGACATTGGTGTTGAGCGG + Intergenic
968993512 4:3930347-3930369 GATGGGATATTGGCGTTGAGTGG - Intergenic
969653955 4:8485513-8485535 GATGGGATATTGGCATTGAGCGG + Intronic
970029104 4:11656478-11656500 GATGGGATATTGGCATTGAGAGG + Intergenic
970087670 4:12366741-12366763 GATGGGATATTGGCATTGAGTGG - Intergenic
970256286 4:14173258-14173280 GATGGTATATTGGCGTTGAGTGG + Intergenic
970532872 4:17000638-17000660 GATGGGATATTGGCGTTGAGTGG - Intergenic
970923697 4:21425052-21425074 GAAGGGACATTGGAGAGGAGAGG + Intronic
971123053 4:23724759-23724781 GATGGGATATTGGCATTGAGTGG + Intergenic
971200267 4:24503986-24504008 GATGGGATATTGGCGTTGAGTGG - Intergenic
973585299 4:52384382-52384404 GATGTGAATTTGGGGGTGAGGGG + Intergenic
973751253 4:54022778-54022800 GATGGGATATTGGCATTGAGCGG - Intronic
974428270 4:61767035-61767057 GATGGGATATTGGCGTTGAGTGG + Intronic
974831959 4:67200801-67200823 AGTGGGAGTTTGAAGTTGAGAGG - Intergenic
975864961 4:78716595-78716617 GATGGGATATTGGCGTTGAGTGG + Intergenic
975933759 4:79556712-79556734 GATGGGATATTGGCGTTGAGTGG + Intergenic
976696672 4:87924839-87924861 GATGGGATATTGGCGTTGAGTGG - Intergenic
977010446 4:91627055-91627077 GATGGGATATTGGCGTTGAGTGG - Intergenic
977062374 4:92274237-92274259 GATGGGATATTGGCATTGAGTGG + Intergenic
977075072 4:92441701-92441723 GATGGGATATTGGCATTGAGTGG + Intronic
977198299 4:94087368-94087390 GATGGGATATTGGCGTTGAGTGG + Intergenic
977225214 4:94386205-94386227 GATGGGATATTGGCGTTGAGCGG + Intergenic
977446308 4:97137341-97137363 GATGGGATATTGGCATTGAGAGG + Intergenic
977973456 4:103237435-103237457 GATGGGAGGTTGGAGTTGAGTGG + Intergenic
977986809 4:103392175-103392197 GATGGGAGGTTGGAGTAGAGTGG - Intergenic
978000989 4:103556498-103556520 GATGGGATATTGGCGTTGAGTGG + Intergenic
978438746 4:108712125-108712147 GATGGGATATTGGCATTGAGTGG - Intergenic
978459178 4:108931252-108931274 GACGGGACTTTAGAGTTGGAAGG + Intronic
979146739 4:117255066-117255088 GATGGGATATTGGCATTGAGGGG - Intergenic
979380071 4:119996897-119996919 GATGGGATATTGGCGTTGAGTGG - Intergenic
979895035 4:126147880-126147902 GATGGGATATTGGCATTGAGCGG + Intergenic
980111794 4:128643602-128643624 GATGGGATATTGGCGTTGAGTGG + Intergenic
980190314 4:129516778-129516800 GATTGGATCTTGGAGTTGGGTGG - Intergenic
980254818 4:130365397-130365419 GAAGGGACCTTGCTGTTGAGAGG - Intergenic
980285069 4:130770337-130770359 GATGGGATATTGGCATTGAGCGG - Intergenic
980389051 4:132121171-132121193 GATGGGATATTGGCATTGAGCGG - Intergenic
980491228 4:133531933-133531955 GATGGGATATTGGCATTGAGCGG + Intergenic
980575498 4:134680648-134680670 GATGGGATATTGGCATTGAGCGG + Intergenic
980886119 4:138764642-138764664 GATGGGCCTTGGAAGTTGGGAGG + Intergenic
980904068 4:138930839-138930861 GATGGGATATTGGCATTGAGCGG - Intergenic
981008285 4:139897878-139897900 GCTGAAAGTTTGGAGTTGAGTGG - Intronic
981269647 4:142830498-142830520 GAGGGGAATATGGAGTGGAGAGG + Intronic
981525342 4:145702064-145702086 GATGGGATATTGGCGTTGAGTGG - Intronic
981539853 4:145835721-145835743 GATGGGATACTGGCGTTGAGTGG - Intronic
981934535 4:150224995-150225017 TATGGGACTTGGGAGTTAAGGGG - Intronic
982083846 4:151815348-151815370 GATGGGATATTGGCGTTGAGCGG + Intergenic
982180349 4:152744068-152744090 GATGGGATATTGGCATTGAGTGG + Intronic
982318939 4:154059248-154059270 GATGGGATACTGGTGTTGAGCGG - Intergenic
982414072 4:155111204-155111226 GATGGGATCTTGGCATTGAGCGG + Intergenic
982535574 4:156603256-156603278 GATGGGATATTGGCATTGAGTGG - Intergenic
982829633 4:160043754-160043776 TGTGGAACTTTGGAATTGAGAGG - Intergenic
982943393 4:161587558-161587580 AATAGGACTTTGGAGATGATGGG - Exonic
983055613 4:163096047-163096069 GATAGGATATTGGCGTTGAGCGG - Intergenic
983345688 4:166523498-166523520 GATGGGATATTGGCATTGAGCGG - Intergenic
983360540 4:166719279-166719301 GATGGGATATTGGCGTTGAGTGG - Intergenic
983414582 4:167438545-167438567 GATGGGATATTGGCATTGAGTGG + Intergenic
983448179 4:167879227-167879249 GATGGGATATTGGCATTGAGTGG - Intergenic
983452461 4:167925865-167925887 GATGGGATCTTGGCATTGAGCGG - Intergenic
983659702 4:170119425-170119447 GATGGGATATTGGCATTGAGCGG - Intergenic
983883633 4:172959105-172959127 GATGGGATATTGGCATTGAGTGG + Intronic
984098920 4:175464175-175464197 GATGGGATATTGGCATTGAGTGG + Intergenic
984322318 4:178210063-178210085 GATGGGATATTGGCATTGAGTGG - Intergenic
984393483 4:179167629-179167651 GATGGGATATTGGCGTTGAGTGG + Intergenic
984411867 4:179406259-179406281 GATGGGATATTGGCATTGAGTGG - Intergenic
984437394 4:179723420-179723442 GATGGGATATTGGCATTGAGTGG - Intergenic
984662482 4:182388180-182388202 GATGGAACTTTGAACTAGAGTGG - Intronic
984700807 4:182817494-182817516 GATGGGATATTGGCGTTGAGCGG - Intergenic
985078879 4:186244849-186244871 GATGGGATATTGGCATTGAGCGG + Intronic
985435840 4:189928829-189928851 GATGGGATATTGGCATTGAGAGG - Intergenic
985582479 5:705761-705783 GATGGGATATTGGCGTTGAGTGG - Intergenic
986193656 5:5518518-5518540 GGTGGGATATTGGCGTTGAGCGG - Intergenic
986389010 5:7266559-7266581 GATGGGATATTGGCGTTGAGTGG - Intergenic
986554917 5:9001281-9001303 GATGGGATTTTGGCATTGAGCGG + Intergenic
986905896 5:12492720-12492742 GATGGGATATTGGCGTTGAGCGG - Intergenic
986919455 5:12665275-12665297 GATGGGATATTGGCGTTGAGTGG + Intergenic
987497993 5:18671593-18671615 GATGGGATATTGGCATTGAGTGG + Intergenic
988683266 5:33503375-33503397 GAAGGGATTCTGGAATTGAGTGG + Intergenic
989688791 5:44117457-44117479 GATGGGATATTGGCATTGAGTGG + Intergenic
992394797 5:76360330-76360352 GATGGGATATCGGTGTTGAGTGG - Intergenic
992451871 5:76883124-76883146 GATGGGATATTGGCATTGAGTGG + Intronic
992633847 5:78708304-78708326 GATGGGATTTTGGAGTACAGTGG + Intronic
993836823 5:92826934-92826956 GATGGGATATTGGCATTGAGTGG - Intergenic
994125978 5:96169624-96169646 GATGGGATATTGGCGTTGAGTGG + Intergenic
994295271 5:98082041-98082063 GATGGGATATTGGCATTGAGTGG - Intergenic
994778823 5:104066937-104066959 GATGGGATATTGGCATTGAGTGG + Intergenic
994855157 5:105111120-105111142 GCTGGTTCTTGGGAGTTGAGAGG - Intergenic
994989680 5:106981338-106981360 GATGGGATATTGGCATTGAGTGG - Intergenic
995098453 5:108269099-108269121 GATGGGAAATTGAAGCTGAGGGG - Intronic
995122634 5:108552248-108552270 GATGGGATATTGGCGTTGAATGG - Intergenic
995125035 5:108571206-108571228 GATGGGATATTGGCGTTGCGTGG + Intergenic
995296799 5:110532814-110532836 GATGGGATATTGGCATTGAGCGG - Intronic
995899241 5:117049112-117049134 GATGGGATATTGGCATTGAGCGG + Intergenic
996052500 5:118949628-118949650 GATGGGATATTGGCATTGAGTGG + Intronic
996203127 5:120700325-120700347 GATGGGATATTGGCCTTGAGTGG + Intergenic
996344689 5:122476339-122476361 GATGGGATATTGGTGTTGAGTGG + Intergenic
996358486 5:122621604-122621626 GATGGGATATTGGCATTGAGCGG + Intergenic
996510021 5:124306761-124306783 GATGGGATATTGGCATTGAGGGG - Intergenic
996553669 5:124756121-124756143 GATGTGTCTTTGGATTTTAGAGG + Intergenic
996725738 5:126672325-126672347 GATGGGATATTGGCATTGAGTGG + Intergenic
996745307 5:126842291-126842313 GATGGGATATTGGTGTTGAGTGG + Intergenic
997040677 5:130249483-130249505 GAATGGACTTTGGAGTTAAAGGG - Intergenic
997746530 5:136304285-136304307 GATGGGATCTTGGCATTGAGCGG - Intronic
997772518 5:136568086-136568108 GATGGGATATTGGCATTGAGTGG + Intergenic
997823929 5:137089685-137089707 GATGGGACTTTGGAGTTGAGGGG - Intronic
998386181 5:141758352-141758374 GGTGGGAGTGTGGAGTTGTGGGG + Intergenic
998693575 5:144614089-144614111 GATGGGATATTGGCGTTGAGCGG + Intergenic
998754763 5:145364845-145364867 GATAGGACTTTGAGTTTGAGTGG - Intergenic
998995519 5:147866262-147866284 GATGGGATATTGGCGTTGAGTGG - Intergenic
998996271 5:147871722-147871744 GATGGGATATTGGTGTTGAGTGG + Intronic
999618738 5:153452444-153452466 GATGGGATATTGGCGTTGAGTGG + Intergenic
1000439848 5:161251467-161251489 GATGGGATATTGGCGTTGAGTGG - Intergenic
1000519281 5:162278135-162278157 GATGGGATATTGGCATTGAGTGG + Intergenic
1001331321 5:170764781-170764803 GATGGGATATTGGCATTGAGCGG + Intronic
1001700309 5:173701959-173701981 GATGGGGCTTTGGAGACAAGGGG - Intergenic
1001714259 5:173802174-173802196 GAAGGGACATTGGAGCAGAGTGG + Intergenic
1001892470 5:175350974-175350996 GATGGAACTGGGGAGTTTAGTGG - Intergenic
1002610822 5:180417462-180417484 GATGGGATATGGGCGTTGAGCGG + Intergenic
1002985024 6:2181269-2181291 GGTGGGAATTAGGAATTGAGAGG - Intronic
1003377776 6:5595067-5595089 GAAGGGGGTTTGGAGCTGAGAGG + Intronic
1003430045 6:6030527-6030549 GATGGGATATTGGCATTGAGCGG + Intergenic
1003677620 6:8221276-8221298 GATGGGATTCTGTAGTTCAGAGG - Intergenic
1004106389 6:12670343-12670365 GATGGGATATTGGCATTGAGTGG - Intergenic
1005014523 6:21364242-21364264 GATGGGATATTGGCGTTGAGTGG + Intergenic
1006147305 6:31967386-31967408 GATGGGAATTTGGACTCCAGAGG + Intronic
1006195860 6:32241937-32241959 GAAAGGACCTTGGAGTTGAAAGG + Intergenic
1006443146 6:34064475-34064497 GATAGGATTGTGGAGTTGAGGGG + Intronic
1006451010 6:34105688-34105710 GATGGGAGCCTGGAGTTCAGGGG - Intronic
1007048676 6:38803511-38803533 GTTGGGAACTTGGATTTGAGAGG - Intronic
1008010929 6:46466968-46466990 GATGTGACTTTGAAGATGAGTGG - Intronic
1008476659 6:51941156-51941178 GATGGGATATTGGCATTGAGTGG - Intronic
1008850081 6:56013554-56013576 GATGGGATATTGGCATTGAGTGG + Intergenic
1009161272 6:60285947-60285969 GAGGTCACATTGGAGTTGAGAGG - Intergenic
1009269946 6:61603078-61603100 GATGGGATATTGGCATTGAGCGG - Intergenic
1009359473 6:62794480-62794502 GATGGGATATTGGCATTGAGTGG - Intergenic
1009379267 6:63008273-63008295 GATGGGATATTGGCATTGAGTGG - Intergenic
1009883408 6:69597007-69597029 AATGGGAATTTGGGGTGGAGGGG + Intergenic
1010071595 6:71751287-71751309 GATGGGATATTGGCATTGAGTGG + Intergenic
1010586563 6:77663290-77663312 GATGGGATATTGGCATTGAGTGG + Intergenic
1010660855 6:78569385-78569407 GATGAGACTTTGGACTTTTGGGG - Intergenic
1010841171 6:80650498-80650520 GATGGGATATTGGCCTTGAGTGG + Intergenic
1010894417 6:81347882-81347904 GATGGGATATTGGCATTGAGTGG + Intergenic
1011219788 6:85042159-85042181 GTAGGGAATTTGGAGTTCAGAGG - Intergenic
1011770809 6:90672947-90672969 GATGGGATATTGGCGTTGAGTGG + Intergenic
1011799096 6:90990904-90990926 TATCAGACTTTGGAGTTGGGTGG + Intergenic
1012014257 6:93832813-93832835 GATGGGATATTGGCATTGAGTGG + Intergenic
1012066411 6:94556679-94556701 GATGGGATATTGGTGTTGAGTGG + Intergenic
1012648429 6:101719567-101719589 ATTAGGACTTTGGAGTTCAGTGG + Intronic
1012675225 6:102104927-102104949 GATGGGATATTGGCATTGAGTGG - Intergenic
1012689706 6:102295902-102295924 GATGGGATATTGGCATTGAGCGG - Intergenic
1013843577 6:114425212-114425234 GATGGGATATTGGCGTTGAGTGG + Intergenic
1013891838 6:115034855-115034877 GATGGGATATTGGAGTTGGGTGG - Intergenic
1014007466 6:116436417-116436439 GATGGGACTTCGGAGGTGCATGG - Exonic
1014115219 6:117662456-117662478 GATGGGATATTGGCGTTGAGCGG + Intergenic
1014360033 6:120465018-120465040 GATGGGATATTGGCGTTGAGTGG + Intergenic
1014454737 6:121623174-121623196 GATGGGATATTGGCATTGAGTGG + Intergenic
1014719025 6:124895012-124895034 GATGGGATGTTGGCATTGAGTGG - Intergenic
1015266875 6:131298423-131298445 GATGGGATATTGGTGTTGAGTGG - Intergenic
1015268912 6:131318973-131318995 AAAGTGACTTTGGAGTTGGGGGG - Intergenic
1015323961 6:131904658-131904680 GATGGGATATTGGCGTTGAGTGG - Intergenic
1016114014 6:140260183-140260205 GATGGGATATTGGCGTTGAGTGG + Intergenic
1016204659 6:141455787-141455809 GATGGGATATTGGCATTGAGTGG - Intergenic
1016518934 6:144926143-144926165 GATGGGATATTGGCATTGAGCGG - Intergenic
1016535631 6:145105889-145105911 GATGGGATATTGGCATTGAGCGG + Intergenic
1016650160 6:146453160-146453182 GATGGGATATTGGCGTTGAGCGG + Intergenic
1017717143 6:157221034-157221056 GAAGGGACTCTGGAGGTGCGGGG - Intergenic
1018135842 6:160777855-160777877 GATGGGATGTTGGCATTGAGCGG - Intergenic
1018495266 6:164341476-164341498 GATGGGATATTGGCATTGAGGGG + Intergenic
1019336179 7:484036-484058 GAGGGGGGGTTGGAGTTGAGAGG - Intergenic
1020316174 7:6906753-6906775 GATGGGATATTGGCGTTGAGTGG - Intergenic
1020323830 7:6959451-6959473 GATGGGATATTGGCATTGAGCGG + Intergenic
1020532588 7:9356160-9356182 GATGGGATATTGGTGTTGACCGG + Intergenic
1021172801 7:17416813-17416835 GATGGGATGTTGGCATTGAGTGG - Intergenic
1021393751 7:20123569-20123591 GATGGGATATTGGCATTGAGTGG - Intergenic
1021429976 7:20548414-20548436 GATGGGACACTGGCGTTGAATGG - Intergenic
1021637447 7:22706214-22706236 GATGGGATATTGGCGTTGAGCGG - Intergenic
1021660754 7:22916081-22916103 GATGGGATATTGGCATTGAGCGG - Intergenic
1021810785 7:24399242-24399264 GATGGGATATTGGTGTTGAGTGG - Intergenic
1022373006 7:29787813-29787835 GATGGGATATTGGCGTTGAGCGG - Intergenic
1022447528 7:30482192-30482214 GATGGGATATTGGCGTTGAGCGG - Intergenic
1022572666 7:31469770-31469792 GATGGGATATTGGCATTGAGCGG + Intergenic
1022709203 7:32835346-32835368 GATGGGATATTGGCATTGAGCGG - Intergenic
1022854618 7:34302856-34302878 GATGGGATATTGGCATTGAGCGG + Intergenic
1023698757 7:42873351-42873373 GATGGGATACTGGCGTTGAGTGG + Intergenic
1024044213 7:45576033-45576055 GATGGGGCTGGGGAGTTGGGGGG + Intronic
1026439295 7:70429895-70429917 GTTGGGATTTGGGAGTTGAGGGG + Intronic
1027158448 7:75784898-75784920 GATGGGATATTGCCGTTGAGCGG - Intronic
1027852083 7:83462636-83462658 GATGGGATATTGGCGTTGAGTGG - Intronic
1028670635 7:93396906-93396928 GATGGGATATTGGCATTGAGTGG - Intergenic
1029374560 7:100170103-100170125 GAAGGGACTTTGCAGGTGAATGG - Exonic
1029481645 7:100817108-100817130 GATGGGACTTTGGAGACCTGGGG + Intronic
1029500335 7:100925133-100925155 GATGGGATATTGGCATTGAGCGG - Intergenic
1030751374 7:113236323-113236345 GATAGGATATTGGCGTTGAGCGG + Intergenic
1031033041 7:116755407-116755429 GCTGGGACTTTGGATTTCGGAGG + Exonic
1031364630 7:120888356-120888378 GATGGGATATTGGCATTGAGCGG + Intergenic
1031400115 7:121318541-121318563 GATGGGATATTGGCGTTGAGTGG - Intergenic
1031525722 7:122819895-122819917 GATGGGATATTGGCGTTGAGTGG - Intronic
1031777461 7:125920547-125920569 GATGGGATATTGGCATTGAGTGG - Intergenic
1032330600 7:130975525-130975547 GATGAGACTTTGGATTTTTGAGG + Intergenic
1032446214 7:131985973-131985995 GATGGGAGCTTGGATTGGAGGGG - Intergenic
1032719361 7:134538145-134538167 GAGGGGTCTTTGGAGCTGAGTGG + Intronic
1032790657 7:135240194-135240216 TATAGGACTTAAGAGTTGAGGGG - Intronic
1033211648 7:139464263-139464285 GATGGGATATTGGCGTTTAGCGG - Intronic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1033675815 7:143539961-143539983 GATGGGATCTTGGCGTTGAGTGG + Intergenic
1034084695 7:148312787-148312809 GATGGGATATTGGCATTGAGGGG + Intronic
1036281609 8:7405408-7405430 GATGGGATATTGGTGTTGAGTGG - Intergenic
1036339861 8:7906164-7906186 GATGGGATATTGGTGTTGAGTGG + Intergenic
1036372238 8:8171533-8171555 GATGGGATATTGGCATTGAGAGG - Intergenic
1036515297 8:9438178-9438200 ACTGGGACTTTAGAGGTGAGAGG - Intergenic
1036639611 8:10574239-10574261 GATGGGATATTGGCATTGAGCGG - Intergenic
1036878664 8:12494108-12494130 GATGGGATATTGGCATTGAGAGG + Intergenic
1037827000 8:22165523-22165545 CAGGGGTCTTTGTAGTTGAGGGG - Exonic
1039391427 8:37184049-37184071 GATCGGCCTTTGGAGGGGAGGGG - Intergenic
1041917413 8:63151071-63151093 GATGGGATATTGGCATTGAGTGG + Intergenic
1042453693 8:68976146-68976168 GATGGGATATTGGCGTTGAGTGG - Intergenic
1042707504 8:71677885-71677907 GATGGGATATTGGCGTTGAGTGG - Intergenic
1042716114 8:71774713-71774735 GATGGGACTTTCGGTTTAAGAGG + Intergenic
1042811798 8:72833769-72833791 GAAGGGCCTTCAGAGTTGAGAGG + Intronic
1043597326 8:81901279-81901301 GATGGGATATTGGCGTTGAGTGG + Intergenic
1043717771 8:83507887-83507909 GATGGGATATTGGCATTGAGCGG + Intergenic
1043837854 8:85065943-85065965 GATGGGATGTTGGCATTGAGCGG - Intergenic
1044148391 8:88744949-88744971 GATGGGATTTTGGCATTGATCGG + Intergenic
1044258490 8:90092950-90092972 GATGGGATATTGGCATTGAGTGG + Intronic
1044417221 8:91950934-91950956 GATGGGATATTGGCGTTGAGCGG - Intergenic
1044546858 8:93469651-93469673 GATGGTAGTTTGGATTTGTGTGG - Intergenic
1044565220 8:93655186-93655208 GTTTGGAGTTTGGAGTAGAGAGG + Intergenic
1045197658 8:99946845-99946867 GATGGGATCTTGGCGTTGAGTGG - Intergenic
1045569074 8:103351308-103351330 GATGGCAATTTGGAGATGGGTGG + Intergenic
1045621964 8:103988790-103988812 GATGGTAGTTTGGACTGGAGTGG + Intronic
1045644913 8:104288907-104288929 GATGGGATATTGGCGTTGAGTGG - Intergenic
1046294248 8:112198798-112198820 GATGGGATATTGGCATTGAGTGG - Intergenic
1046386212 8:113512250-113512272 GATGGGATATTGGCGTTGAGTGG + Intergenic
1046440142 8:114244312-114244334 GATGGGATATTGGCGTTGCGTGG - Intergenic
1046443377 8:114284960-114284982 GATGGGATATTGGCGTTGAGTGG - Intergenic
1046512211 8:115215200-115215222 GATGCGATATTGGCGTTGAGTGG - Intergenic
1046559402 8:115817573-115817595 GATAGGATATTGGCGTTGAGCGG - Intergenic
1047122503 8:121921692-121921714 AATGGGGTTTTGGAGGTGAGAGG - Intergenic
1047699478 8:127434691-127434713 GATGGGATATTGGCGTTGAGTGG - Intergenic
1048143889 8:131822163-131822185 GATGGGATATTGGCATTGAGCGG - Intergenic
1048168301 8:132082971-132082993 GATGGGATATTGGCATTGAGTGG + Intronic
1048585299 8:135769887-135769909 GATGGGATATTGGCATTGAGTGG + Intergenic
1048728297 8:137411012-137411034 GATGGGATATTGGCATTGAGCGG + Intergenic
1048764109 8:137827561-137827583 GATGGGATATTGGCATTGAGTGG + Intergenic
1051052759 9:12951318-12951340 GATGGGATATTGGTGTTGAGTGG - Intergenic
1051144324 9:14010462-14010484 GATGGGAAATTGAAGTTAAGAGG + Intergenic
1051437078 9:17044345-17044367 GAGGAGACAGTGGAGTTGAGAGG + Intergenic
1052653467 9:31329382-31329404 GATGGGATATTGGCATTGAGCGG - Intergenic
1052720516 9:32167265-32167287 GATGGGATGTTGGCGTTGAGCGG + Intergenic
1053058156 9:35006458-35006480 GATGGGATATTGGCATTGAGCGG - Intergenic
1054916943 9:70503438-70503460 GATGGGATGTTGGACCTGAGTGG + Intergenic
1055233198 9:74088634-74088656 GATGGGATATTGGCGTTGAGTGG - Intergenic
1055347586 9:75354520-75354542 GATGGGATATTGGCATTGAGTGG + Intergenic
1055810184 9:80140386-80140408 GATGGGATATTGGCGTTGAGTGG - Intergenic
1056044604 9:82703456-82703478 GATGGGATATTGGCATTGAGCGG + Intergenic
1056061286 9:82886721-82886743 GATGGGATATTGGCGTTGAGTGG - Intergenic
1056324020 9:85461618-85461640 GATGGGATATTGGTGTTGAGTGG - Intergenic
1056522580 9:87413897-87413919 GATGGGATATTGGTGTTGAGTGG - Intergenic
1056883109 9:90415548-90415570 AATGGGATATTGGCGTTGAGTGG - Intergenic
1057234980 9:93350581-93350603 AATGGGATATTGGTGTTGAGTGG - Intergenic
1057378117 9:94542789-94542811 GATGGGATATTGGCATTGAGCGG - Intergenic
1057684127 9:97217807-97217829 GATGGGATATTGGCGTTGAGTGG - Intergenic
1057812457 9:98268548-98268570 GATGGGATATTGGCATTGAGCGG + Intergenic
1057982218 9:99673134-99673156 GATGGGATATTGGTGTTGAGTGG - Intergenic
1059546048 9:115177359-115177381 GATGGGATATTGGGATTGAGCGG + Intronic
1059574744 9:115476320-115476342 GATGGGATATTGGCATTGAGCGG - Intergenic
1059606574 9:115841939-115841961 GATGGGATATTGGCATTGAGTGG + Intergenic
1059863358 9:118488407-118488429 GATGGGATATTGGCATTGAGTGG + Intergenic
1060318345 9:122533373-122533395 GATGGGATATTGGCATTGAGTGG + Intergenic
1060407939 9:123381952-123381974 GATGGGACAAAGGGGTTGAGTGG + Exonic
1060737750 9:126077363-126077385 GATGGGATATTGGCATTGAGCGG + Intergenic
1061421377 9:130474560-130474582 GATGGGGCTGTGGAGTTGTGTGG + Intronic
1062668958 9:137695081-137695103 GATGGGAATTTGGAGTTTTTGGG + Intronic
1185858300 X:3555869-3555891 GATGAGATATTGGCGTTGAGCGG + Intergenic
1185960564 X:4543218-4543240 GATGGGATATTGGTGTTGAGCGG + Intergenic
1185991185 X:4894557-4894579 GATGAGATATTGGCGTTGAGCGG - Intergenic
1186112722 X:6274921-6274943 GATGGGATATTGGCATTGAGCGG + Intergenic
1186591809 X:10938575-10938597 GCTGGGACTTTAGAGCTGGGTGG - Intergenic
1186784202 X:12942810-12942832 GATGGGATATTGGCATTGAGCGG - Intergenic
1187099839 X:16181905-16181927 GATGGGATATTGGCATTGAGCGG + Intergenic
1187333291 X:18360362-18360384 GAAGTGACATTTGAGTTGAGAGG + Intergenic
1188332890 X:28895353-28895375 GATGGGATATTGGCATTGAGGGG + Intronic
1188419628 X:29978311-29978333 GATGGGATATTGGCATTGAGCGG - Intergenic
1188431156 X:30106320-30106342 GATGGGATATTGGCATTGAGCGG - Intergenic
1188552785 X:31380475-31380497 GATGGGATGTTGGCATTGAGCGG - Intronic
1188891229 X:35612435-35612457 GATGGGATATTGGCATTGAGTGG - Intergenic
1190465819 X:50724113-50724135 GATGGGATATTGGCGTTGAGCGG - Intronic
1192454768 X:71267457-71267479 GATGGGATATTGGCATTGAGTGG - Intergenic
1192534920 X:71919082-71919104 GATGGGATTATGGGGATGAGTGG + Intergenic
1192706271 X:73530648-73530670 GATGGGATATTGGCATTGAGCGG - Intergenic
1192731390 X:73805651-73805673 GATGGGATATTGGCATTGAGCGG + Intergenic
1192920792 X:75703608-75703630 GATGGAACTTTTGGGTTGGGGGG - Intergenic
1193537202 X:82729799-82729821 GATGGGATATTGGCATTGAGTGG - Intergenic
1194186122 X:90776061-90776083 GATGGGATATTGGCATTGAGTGG + Intergenic
1194293490 X:92102980-92103002 GATGGGATATTGCCGTTGAGCGG + Intronic
1194308416 X:92275803-92275825 GATGGGATATTGGTGTTGAGCGG + Intronic
1194351415 X:92827466-92827488 GATGGGATATTGGCGTTGAGCGG - Intergenic
1194502850 X:94701559-94701581 GATGGGATATTGGCATTGAGCGG + Intergenic
1194696964 X:97064511-97064533 GATGGAACAATGGTGTTGAGGGG - Intronic
1194822640 X:98527004-98527026 GATGGGATATTGGCATTGAGTGG + Intergenic
1195291031 X:103432269-103432291 GATGGGATATTGGCATTGAGCGG + Intergenic
1195598495 X:106720141-106720163 GAAGGAACTATGGAGATGAGTGG - Intronic
1196073216 X:111546895-111546917 GATGGGATATTGGCGTTGAGTGG - Intergenic
1196099903 X:111837134-111837156 GATGAGAGTCTGGAGTTCAGGGG + Intronic
1196227090 X:113179532-113179554 GATGGGGTATTGGCGTTGAGCGG + Intergenic
1196330953 X:114469735-114469757 GATGGGATACTGGTGTTGAGTGG - Intergenic
1196341586 X:114604036-114604058 GATGGGATATTGGCGTTGAGTGG + Intronic
1196525346 X:116723695-116723717 GATGGGATATTGGCATTGAGTGG + Intergenic
1196533418 X:116815222-116815244 GATGGGATATTGGCGTTGAGCGG + Intergenic
1196585240 X:117420598-117420620 GATGGGATATTGGCGTTGAGTGG - Intergenic
1197014857 X:121611640-121611662 GAAGGCACTTTGGACTGGAGTGG + Intergenic
1197065045 X:122225008-122225030 GATGGGATATTGGCGTTGAGTGG - Intergenic
1197351926 X:125391582-125391604 GATGGGATATTGGCTTTGAGTGG + Intergenic
1197499846 X:127229564-127229586 GATGGGATATTGGCATTGAGAGG - Intergenic
1198599269 X:138267055-138267077 GATGGGATATTGGCGCTGAGCGG + Intergenic
1199377325 X:147128926-147128948 GATGGGACTGCTGAGTTGAATGG + Intergenic
1199576605 X:149318633-149318655 GATGGGATCTTGGCATTGAGTGG - Intergenic
1200272858 X:154703122-154703144 GATGGGACTGCTGGGTTGAGTGG - Intronic
1200532717 Y:4358141-4358163 GATGGGATATTGGCATTGAGTGG + Intergenic
1200611010 Y:5327526-5327548 GATGGGATATTGCCGTTGAGCGG + Intronic
1200659736 Y:5944158-5944180 GATGGGATATTGGTGTTGAGCGG - Intergenic
1200695217 Y:6352594-6352616 ATTGGGACTTTGGAGCTGAATGG + Intergenic
1200812965 Y:7503699-7503721 GATAGGATACTGGAGTTGAGCGG - Intergenic
1201040060 Y:9822116-9822138 ATTGGGACTTTGGAGCTGAATGG - Intergenic
1201303646 Y:12532157-12532179 CATGGGAGTTTGCAGGTGAGTGG + Intergenic
1201307391 Y:12562691-12562713 GATGGGATATTGGCATTGAGCGG + Intergenic
1201473418 Y:14357286-14357308 GATGGGATATTGGCATTGAGTGG + Intergenic
1201581509 Y:15515352-15515374 GATGGGATATTGGCATTGAGTGG - Intergenic
1201910857 Y:19132362-19132384 GTTGGGACCTTGGAGCTGAATGG - Intergenic