ID: 997824002

View in Genome Browser
Species Human (GRCh38)
Location 5:137090402-137090424
Sequence TGTGATCTGCAGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 0, 2: 8, 3: 50, 4: 513}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997824002_997824008 9 Left 997824002 5:137090402-137090424 CCTTCCTCCCTCTGCAGATCACA 0: 1
1: 0
2: 8
3: 50
4: 513
Right 997824008 5:137090434-137090456 CACACAAGCATAGACTGTTCAGG 0: 1
1: 0
2: 0
3: 18
4: 107
997824002_997824010 30 Left 997824002 5:137090402-137090424 CCTTCCTCCCTCTGCAGATCACA 0: 1
1: 0
2: 8
3: 50
4: 513
Right 997824010 5:137090455-137090477 GGGAACAACCAACCTTCCACTGG No data
997824002_997824009 10 Left 997824002 5:137090402-137090424 CCTTCCTCCCTCTGCAGATCACA 0: 1
1: 0
2: 8
3: 50
4: 513
Right 997824009 5:137090435-137090457 ACACAAGCATAGACTGTTCAGGG 0: 1
1: 0
2: 1
3: 17
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997824002 Original CRISPR TGTGATCTGCAGAGGGAGGA AGG (reversed) Intronic
900091383 1:922226-922248 AGTGATTTGGAGAGGGAGGCTGG - Intergenic
900578124 1:3394264-3394286 TGTGGCCTGCAGAGAGGGGATGG + Intronic
900892350 1:5458565-5458587 TGTCTTCTGCGGAGGAAGGAAGG - Intergenic
900934438 1:5756247-5756269 TGGGTTCTGCAGGCGGAGGAAGG - Intergenic
901651814 1:10747267-10747289 TGGGGTCTGCAGAGAGAGGCAGG + Intronic
901808180 1:11750722-11750744 TGTGCTCTGAAAAGGGAGGCTGG - Exonic
902242930 1:15100787-15100809 TCCCATCTGCAGAGCGAGGACGG + Intronic
902630207 1:17700375-17700397 TGTGCTCTGGAGAAGGGGGATGG + Intergenic
903404404 1:23084346-23084368 TGTGCTCTGAGGATGGAGGAAGG - Exonic
903963767 1:27073287-27073309 TTGGAAGTGCAGAGGGAGGATGG - Intergenic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904111405 1:28129195-28129217 TGTGATCTACACAGGAAGGAAGG - Intergenic
904416931 1:30368728-30368750 TGGGATGTGAAGAGGGAGAAGGG - Intergenic
904546586 1:31278786-31278808 TGTCTTCGGCAGAGGGATGATGG + Intronic
905095489 1:35466558-35466580 GGAGTCCTGCAGAGGGAGGAAGG + Intronic
905150962 1:35927112-35927134 AGTGAGCTGCAAAAGGAGGAAGG + Exonic
905242123 1:36588178-36588200 TGTGGTATGCTGAGGGAGGGAGG + Intergenic
905410177 1:37763291-37763313 TGTGATTTGAAGATGGAGGAGGG - Intronic
905651633 1:39660801-39660823 TTTGAGCTGCAGAGGGGGGATGG + Intronic
906692481 1:47801686-47801708 TCTGAAGTCCAGAGGGAGGAGGG - Intronic
907438736 1:54465429-54465451 TGAGAGCTCCAGCGGGAGGAGGG - Intergenic
909118857 1:71575117-71575139 GCTGATCTACAGAGAGAGGAAGG + Intronic
909597335 1:77421486-77421508 TGTGATCTCCAAAGGGATTATGG + Intronic
910010503 1:82455447-82455469 TGTCACCTGCAGAGAGAGGCTGG + Intergenic
910048712 1:82951103-82951125 TGTGGCCTGCATAGGGTGGAGGG + Intergenic
910216313 1:84848159-84848181 TGAGCTCTGCAGTGGGTGGAAGG - Intronic
910318022 1:85911148-85911170 TGTGATCTGAAGAGAAAAGATGG - Intronic
910667070 1:89737158-89737180 GGTGCTGTGCAGAGGCAGGATGG - Intronic
911647697 1:100353188-100353210 AGGGAGCTGCAGAGGGAGCAAGG - Intronic
912587254 1:110778355-110778377 TGTCATCTGAAGAGGTAGGCAGG + Intergenic
912671426 1:111630991-111631013 AGGGATCTGCAGAGATAGGAAGG + Intronic
913501803 1:119478589-119478611 TGTGATATGAAGAGGGAGTGGGG + Intergenic
913609144 1:120493473-120493495 TGGGTTCTGCAGGTGGAGGAAGG - Intergenic
914204685 1:145516976-145516998 TGGGTTCTGCAGGTGGAGGAAGG + Intergenic
914370875 1:147023250-147023272 TGGGTTCTGCAGGTGGAGGAAGG - Intergenic
914483808 1:148090163-148090185 TGGGTTCTGCAGGTGGAGGAAGG + Intergenic
914582048 1:149028366-149028388 TGGGTTCTGCAGGTGGAGGAAGG + Intronic
914690135 1:150018424-150018446 TGTGATCTGCAGCCCGGGGAAGG - Intergenic
916157352 1:161866629-161866651 TATGATTTGGAGAGGGAGGTTGG + Intronic
918076503 1:181175146-181175168 TGTGCTTTGGAGATGGAGGAGGG + Intergenic
918126308 1:181587195-181587217 GGTCATCAGCAGAGGGTGGAAGG + Intronic
918362517 1:183773146-183773168 TGTGGTCTGCAGAGAGATCAGGG - Intronic
918748061 1:188231763-188231785 TGTTATCTGCAGATGCTGGAAGG - Intergenic
918925662 1:190782457-190782479 AGTTCTCTGCATAGGGAGGAGGG - Intergenic
920056817 1:203198828-203198850 TGTGCTCTGAAGATGAAGGAAGG + Intergenic
921161434 1:212475020-212475042 TGTGATCAGCACAAAGAGGAAGG + Intergenic
921676612 1:217983161-217983183 AGTGAGCTGTTGAGGGAGGAGGG + Intergenic
921692564 1:218166434-218166456 TGAAATCAGCAGAGAGAGGAGGG + Intergenic
922397500 1:225217501-225217523 TGGAATCTGCAGAGGCAGGCAGG + Intronic
922424082 1:225477938-225477960 TGTGATCTACAGCGGGAGATAGG - Intergenic
923046561 1:230360359-230360381 TGTGACCTGTGGAGGGAGGGAGG + Intronic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
924594083 1:245430149-245430171 TGGGGGCTGAAGAGGGAGGATGG + Intronic
924908737 1:248485796-248485818 TGTAGACTGCAGAGGGAGGATGG + Intergenic
924915371 1:248562266-248562288 TGTAGACTGCAGAGGGAGGATGG - Intergenic
1062990202 10:1807543-1807565 TGTTATCTGCAGAGGCAGCTGGG - Intergenic
1063103805 10:2975016-2975038 TGTGCTCTGCTGAGGGATCACGG - Intergenic
1063218907 10:3948356-3948378 TGGGATGTGGAGAGGGTGGAAGG + Intergenic
1063427617 10:5962205-5962227 AGTCACCTGCACAGGGAGGAAGG - Intronic
1063505228 10:6591812-6591834 TGTTATCTGCTGTGGGAGCAGGG + Intergenic
1064477345 10:15705428-15705450 TTTCATCTGCAGTGGCAGGAGGG - Intronic
1064745875 10:18477668-18477690 AGTGGGCTGCAGAGGGAAGATGG + Intronic
1067059465 10:43070567-43070589 TGTGAGCTGCAGGGACAGGAGGG - Intergenic
1067843964 10:49703716-49703738 TGTTATATCCAGCGGGAGGAAGG - Intronic
1068657180 10:59587836-59587858 TGAGATGTGCTGAGAGAGGAGGG - Intergenic
1069848784 10:71391505-71391527 TGTGCTGTGCAGAGGCAGCAAGG - Intergenic
1069887271 10:71631757-71631779 AGTGATCTGCAGAGCTAGGGAGG - Intronic
1070058015 10:72953953-72953975 TGTGAACTGCAGCAGGGGGAAGG + Intronic
1070119546 10:73562396-73562418 TGTGTTCTGTAGAAGGTGGAGGG - Intronic
1070303623 10:75224141-75224163 TGGCATCTGAAGTGGGAGGAGGG + Intronic
1070555768 10:77526857-77526879 GGAGATATGGAGAGGGAGGATGG - Intronic
1070917460 10:80164005-80164027 AGGGATCTGCAGAGGGCAGAGGG + Intronic
1070993447 10:80753633-80753655 TGTGCTCTGCATAGGAAGGAGGG - Intergenic
1072518458 10:96209787-96209809 TGAGATCTGGGGAGTGAGGATGG - Intronic
1073695815 10:105866066-105866088 TGTATTCTGCAGAGGGCAGATGG - Intergenic
1073702935 10:105950524-105950546 TGTGGCCAGCAGAGGGAGCAAGG + Intergenic
1073857147 10:107690184-107690206 TGGGATCAAAAGAGGGAGGAAGG + Intergenic
1074721110 10:116265949-116265971 AGAGAACTGCAGAGGGAGGGTGG - Intronic
1075608353 10:123832402-123832424 TGTGCACTGGACAGGGAGGAGGG + Intronic
1076434079 10:130427620-130427642 TGTGGTCTCCAGAGAGGGGATGG + Intergenic
1076607644 10:131700010-131700032 TTTGAGCTGCAGAGGGAGCATGG - Intergenic
1079289497 11:19174494-19174516 TGTGTTCTGCATGGGGATGATGG - Intronic
1080915742 11:36656827-36656849 TGTGTTCTGTAGAGGGAGTCGGG + Intronic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1081156287 11:39695933-39695955 TATGATCTGCAGAGTCAAGACGG - Intergenic
1081402261 11:42656966-42656988 TGTGATCAGCTGATGTAGGAGGG - Intergenic
1081590848 11:44422087-44422109 TGTTATGGGCAGGGGGAGGAGGG - Intergenic
1081625547 11:44653249-44653271 TGTGCTCTGCAGTGGGGTGAGGG - Intergenic
1082866190 11:57902051-57902073 CGACAGCTGCAGAGGGAGGAGGG - Intergenic
1083896093 11:65620541-65620563 TCAGATCTGCAGGGAGAGGATGG + Intronic
1083987063 11:66222439-66222461 TGTGATCTGCTGAGGGAGCAGGG - Intronic
1084664558 11:70569447-70569469 TGTGCTGGGCAGAGGGTGGATGG + Intronic
1084741318 11:71141122-71141144 TGTAACCTGCAGGTGGAGGAAGG - Intronic
1086332634 11:85769373-85769395 TGTGTTTTGAAGATGGAGGAAGG + Intronic
1086931609 11:92699710-92699732 TATCATCTGCAGAGGGAAGTAGG + Intronic
1088196249 11:107277114-107277136 TGAAATGTGGAGAGGGAGGATGG - Intergenic
1088430200 11:109750393-109750415 TGTGAGCCGAAGAGGGAAGATGG + Intergenic
1088913435 11:114209383-114209405 TGGGATTTGTGGAGGGAGGAAGG + Intronic
1088948465 11:114539283-114539305 TGTGGTCTGGGGAGGGGGGAGGG + Intronic
1089523069 11:119078548-119078570 TTTGACCTGGAGAGGAAGGAGGG - Exonic
1089623167 11:119734432-119734454 AGTTATCTGCAGAGAGAGGTTGG + Intergenic
1090097456 11:123756929-123756951 TGTGAGATGCAGAGGGAGGTGGG + Intergenic
1090231446 11:125109368-125109390 TTGCCTCTGCAGAGGGAGGAAGG + Intronic
1090334704 11:125954623-125954645 TGTGATCAGAATAGAGAGGAAGG + Intergenic
1090593643 11:128297230-128297252 GGCTTTCTGCAGAGGGAGGAGGG + Intergenic
1090727074 11:129537889-129537911 TGTCTTCTGGAGAGGGATGAAGG - Intergenic
1090873210 11:130766326-130766348 AGTGATCTGCAGGGGAAGGCAGG - Intergenic
1090901207 11:131033381-131033403 GATGCTCTGCAGAGGGAGGCAGG - Intergenic
1090990830 11:131815585-131815607 TGTGCTCTGCAGAGGAAAGGGGG + Intronic
1091049552 11:132355080-132355102 TGTGTTTTGAAGATGGAGGAAGG - Intergenic
1091624994 12:2115054-2115076 TGTGAGATGCTGAGGGAAGAGGG - Intronic
1091686890 12:2568794-2568816 TGGGTTCTGGAGATGGAGGATGG + Intronic
1091893991 12:4085500-4085522 GGTGGTCTTCAGAGAGAGGATGG - Intergenic
1092854525 12:12660200-12660222 TGTGCTCTGGAGAGAGATGAGGG + Intergenic
1093615440 12:21216775-21216797 TGTGCTCTGCAGAGGGTAAAAGG + Intronic
1095208849 12:39469794-39469816 TGTGATCAGGGGAGGGGGGAGGG - Intergenic
1096239974 12:49954613-49954635 ATGGATCTGCAGTGGGAGGAGGG - Exonic
1096752761 12:53772650-53772672 TGGCATCTGGAGAGGGAGGCTGG + Intergenic
1097233870 12:57527061-57527083 AGGGATCTGCAGAGGGAGCCGGG + Exonic
1097263934 12:57735495-57735517 GGAAAGCTGCAGAGGGAGGAGGG - Intronic
1097265241 12:57740555-57740577 TTAGCTCTGGAGAGGGAGGAGGG - Intronic
1097282084 12:57851224-57851246 TGAGGGCTGCAGAGGGAGGGAGG + Intergenic
1098717504 12:73849878-73849900 TGTGAGCTACAGAGAGAAGATGG + Intergenic
1099230741 12:80021078-80021100 AGTGTTCTGCACAGGGGGGAAGG - Intergenic
1100563854 12:95775723-95775745 TGGAATCTGCAGAGGCAGGCAGG - Intronic
1101081478 12:101189802-101189824 TGTGATGTGAAGGTGGAGGATGG - Intronic
1101553266 12:105783401-105783423 TGTGATTTGCACAGTGAAGAAGG - Intergenic
1101592337 12:106136017-106136039 TGTGCTCAGCAGGGGGAGGACGG + Intronic
1101957337 12:109222929-109222951 TGTGCTCTGCAGATGGTGAAAGG - Intronic
1101991503 12:109489391-109489413 TGAGAGCTGCAGAGGGAGCTAGG + Intronic
1102239685 12:111316810-111316832 TGTGAACTGGAGAGAGATGATGG - Intronic
1102430726 12:112881088-112881110 AGTGCTGTGCAGAGGGATGACGG + Intronic
1104211856 12:126696603-126696625 GCTGAACTGCAGAGGCAGGAAGG + Intergenic
1104369869 12:128215113-128215135 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1104369994 12:128215971-128215993 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1104745971 12:131210798-131210820 TGTGAAGAGCAGAGGCAGGAGGG + Intergenic
1105023656 12:132834630-132834652 TGTGCTTTGCAGAGGGAGCAAGG - Intronic
1105450474 13:20494860-20494882 TGTGTGCTGCCCAGGGAGGAAGG - Intronic
1106171761 13:27294739-27294761 AGAGATATGCAGAGGGAAGATGG + Intergenic
1107519330 13:41163596-41163618 TGTGTTTTGTAAAGGGAGGAGGG - Intergenic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1109615443 13:64828469-64828491 GGTGCTCTGCTGAGAGAGGAGGG - Intergenic
1111818364 13:93183416-93183438 TGTGCTTTGCAGATGGAGGAAGG - Intergenic
1112190712 13:97174896-97174918 TGTGAGCTGAAGTGGGAGAAAGG - Intergenic
1112790625 13:102999053-102999075 TGTGATTCACAGAGGGAGGTGGG + Intergenic
1113010333 13:105757907-105757929 TGGGATCTGCATTAGGAGGAAGG - Intergenic
1113232333 13:108226550-108226572 TTTTATCTGAAGAGGGAGAAAGG + Intronic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113856426 13:113448839-113448861 TGTGACCTTGTGAGGGAGGAAGG + Intronic
1113869571 13:113550619-113550641 TGGGTCCTCCAGAGGGAGGAAGG + Intronic
1114049963 14:18914386-18914408 TGGGCTTTGCAGAGGGCGGATGG - Intergenic
1114112594 14:19487544-19487566 TGGGCTTTGCAGAGGGCGGATGG + Intergenic
1114452413 14:22836153-22836175 TGAGACCTGCAGAGGGAGAAGGG - Intergenic
1117123033 14:52589464-52589486 TATCATCTGAAGAGGGTGGATGG + Intronic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119793604 14:77376591-77376613 TGTGATTAGCAGACGGAGGTGGG + Intronic
1119867432 14:77985583-77985605 TGTGATTCACAGAGGCAGGAGGG + Intergenic
1121649805 14:95549613-95549635 TGTACTCTGAAGAGGGCGGAAGG + Intergenic
1123001074 14:105294387-105294409 TGTGCCCTGCCGGGGGAGGATGG - Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126244117 15:46483799-46483821 TATGGTGTGCAGAGGGAAGATGG + Intergenic
1126775285 15:52094979-52095001 TGTAAGAGGCAGAGGGAGGATGG + Intergenic
1127720118 15:61691206-61691228 TGGCATCTGCAGCGGGAGGCAGG - Intergenic
1128367274 15:67013367-67013389 AGTGCTCTGCTGAGGCAGGATGG + Intergenic
1128741243 15:70085360-70085382 TGTGATCTTCTGAGGGAGAAAGG + Intronic
1130156205 15:81352198-81352220 TGTGTTCAGCAGAGGGAGGGAGG + Intronic
1130813706 15:87408243-87408265 TGTGATTTGCAGTGGGAGAAAGG - Intergenic
1131151195 15:90048421-90048443 TGGCATCAGCACAGGGAGGAGGG + Intronic
1131297823 15:91167516-91167538 TGTGTTTTGCAGATGGAGAAAGG - Intronic
1131317191 15:91349738-91349760 TGCGATCTGCAAAGTGGGGATGG + Intergenic
1132011364 15:98279477-98279499 TCTGATCTGCAGAGAGAAGGTGG + Intergenic
1132086201 15:98910232-98910254 TATGATCTGAACAGGGAGCAAGG - Intronic
1133384117 16:5354961-5354983 TGTGATCAGCAGAGGTTGGAAGG + Intergenic
1133492051 16:6279840-6279862 TGGGATCTGGGGAGAGAGGAAGG + Intronic
1134050189 16:11131827-11131849 TGTCATCTGCAGAGAGCCGAGGG - Intronic
1134080201 16:11319699-11319721 CCTGCTCTGCAAAGGGAGGATGG - Intronic
1134371846 16:13633288-13633310 TGTACTTTGCAGATGGAGGAAGG + Intergenic
1134591109 16:15454081-15454103 TGTGATATCCATAGGGAGGGAGG - Intronic
1135117881 16:19738999-19739021 AGGGGTCTGCAGAGGGAGCATGG - Intronic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1136118618 16:28113045-28113067 TTGGACCTGCAGAGGGAAGAGGG + Exonic
1138201037 16:55088590-55088612 TGTGGTGTGCCCAGGGAGGAAGG + Intergenic
1138864327 16:60797998-60798020 TGTGCTCTGCTGGGGAAGGATGG + Intergenic
1140259606 16:73366049-73366071 TGTTTTCTGCACAGGCAGGAAGG + Intergenic
1140522511 16:75593984-75594006 TGTGATCTCCATGGGAAGGAAGG + Intergenic
1140622400 16:76751427-76751449 AGTGAACTGCAGAAGGAGAAGGG + Intergenic
1141268661 16:82519727-82519749 TGTGCTCTGAAGATGGAGGAAGG + Intergenic
1141592824 16:85079998-85080020 TGTGATCTTCAGGGGAGGGAGGG - Intronic
1141717461 16:85735082-85735104 TCTGCCCTGCAGAGGGAGCAGGG - Intronic
1142185012 16:88690715-88690737 TGGGATCTGGGGACGGAGGATGG - Intergenic
1143368392 17:6423049-6423071 TATGGCCTGCAGAGGGAGCAAGG - Intronic
1143782503 17:9236636-9236658 TGAGATCTGCTGGGGGTGGAAGG + Intronic
1143799949 17:9370501-9370523 TGTGATCTTCTTAGGGAGGTGGG - Intronic
1144429417 17:15177421-15177443 TGTGATAGGGAGAGGGAGGAAGG - Intergenic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1146685980 17:34841904-34841926 TGTGTCCTGCAGAGTGAGGCTGG + Intergenic
1146967572 17:37045929-37045951 TCTGATTTGCAGAGGCAGGAAGG + Intronic
1147498198 17:40937501-40937523 TGTGACCTGCAGAGGGACGATGG + Intronic
1147659214 17:42108229-42108251 TGTGAGCTCCAGAGGGAGGCCGG + Intronic
1147911344 17:43858040-43858062 AGTAAACAGCAGAGGGAGGAGGG - Intronic
1147912174 17:43862276-43862298 TGGGGTCTGGAGTGGGAGGAAGG - Exonic
1148049184 17:44760763-44760785 TGGGCTGGGCAGAGGGAGGAAGG + Intronic
1148228484 17:45916290-45916312 TGTGCTCTGCAGAGGGCGGGTGG + Intronic
1148439283 17:47703269-47703291 TGTGAACTCGAGAGAGAGGATGG + Intronic
1148912605 17:50950894-50950916 GGTGACCTGCGGAGGGAGGAGGG - Intergenic
1149036304 17:52138181-52138203 TGTGCTTTGAAGAGGAAGGAAGG - Intronic
1149109271 17:53007624-53007646 TGTCATCTGGTGGGGGAGGATGG + Intergenic
1149932377 17:60769226-60769248 TGTGATAGGCAGGGGCAGGATGG + Intronic
1149967443 17:61179792-61179814 TATGAACTCCAGAGAGAGGAGGG + Intronic
1150650280 17:67005669-67005691 TGTGATCAGCAGAAGGGAGACGG - Intronic
1150867435 17:68868222-68868244 TGGGAGCTGCAGAGGCAGCACGG - Intronic
1151544482 17:74784402-74784424 TGTGATCTGGAGGGGAAGGAAGG + Intronic
1151950386 17:77350259-77350281 TGTGGGCTGCACAGGAAGGAGGG - Intronic
1151956497 17:77382797-77382819 AGTACTGTGCAGAGGGAGGAGGG + Intronic
1152022732 17:77789315-77789337 CGGGCTCTGCAGAGGGAAGAAGG - Intergenic
1152154171 17:78622160-78622182 TGTGAAATGCAGGGAGAGGAGGG - Intergenic
1152238767 17:79151415-79151437 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238783 17:79151453-79151475 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238799 17:79151491-79151513 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238814 17:79151526-79151548 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238829 17:79151561-79151583 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238845 17:79151599-79151621 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238860 17:79151634-79151656 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238877 17:79151672-79151694 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238892 17:79151707-79151729 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238907 17:79151742-79151764 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238937 17:79151815-79151837 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238954 17:79151853-79151875 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152238969 17:79151888-79151910 GGGGACCTGCAGGGGGAGGAGGG + Intronic
1152775825 17:82201414-82201436 TGGAATCAGCAGCGGGAGGAGGG + Intronic
1152803451 17:82342936-82342958 GGTGATCTGCGGAGGTGGGAGGG + Intergenic
1153028496 18:691983-692005 AGTGAACTGCAGAGGAAAGAAGG + Intronic
1153758056 18:8303068-8303090 GGTGATCTGTGGAGGGAGCAAGG + Intronic
1153924720 18:9825924-9825946 TGGGAGCTTCAGAGGCAGGAAGG + Intronic
1153931742 18:9885369-9885391 TGTGTTGTGCAGAGTGAGGGTGG + Intergenic
1155761400 18:29572474-29572496 GGTGAACTGCAGAGGAAGGCTGG + Intergenic
1156445121 18:37230951-37230973 TGTGAGCTGCAGAGGGGAGAAGG - Intronic
1157172858 18:45424070-45424092 TGAGATGGGCAGAGGGAGGGAGG + Intronic
1157335798 18:46736646-46736668 TTTGATCTGCTGAGGAAGAATGG + Intronic
1158634936 18:59148162-59148184 GGTGATCTGCAGAGCCAGGTGGG - Intronic
1159946873 18:74450547-74450569 TGTGAAAAGCAGAGTGAGGAGGG + Intronic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160104885 18:75964769-75964791 TGTGACCTGCCGGGAGAGGAAGG + Intergenic
1160419707 18:78735626-78735648 TGTGCACTGCGGAGGGAGCAGGG - Intergenic
1160842897 19:1154397-1154419 CATGATCTGCAGAGGGAGACGGG + Exonic
1160904936 19:1447514-1447536 TGCGTTCTGCAGTGGGAGAAGGG + Intronic
1161319457 19:3634227-3634249 TGGGATCTGGGGAGGGAGGGAGG + Intronic
1161362435 19:3858294-3858316 TGGGATCTGCAGATAGAGGCAGG + Intronic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1163738585 19:18996910-18996932 TGTGCTCTTGAGAGGGAGGGAGG + Intronic
1164506319 19:28864132-28864154 TGTGAGCTGCCCAGGGACGAGGG - Intergenic
1164545422 19:29157693-29157715 AGAGATCTGCAGAGGCAAGACGG - Intergenic
1164790394 19:30972572-30972594 TGTCATCTGCAGAGGGGGCTAGG - Intergenic
1165032468 19:33008052-33008074 TGTGATCGGCAGACGCAGGCTGG - Exonic
1166654912 19:44603936-44603958 TGTCTTCTGCAGAGAGAGGGGGG + Intergenic
1166913954 19:46181488-46181510 TGTGATCTACAGAGGTAGTTGGG - Intergenic
1167105280 19:47426814-47426836 ACTGATCTGCAGTGGGAGGTGGG - Intergenic
1167224886 19:48231063-48231085 AGCGATGTGCAGAGGGAGGTGGG + Intronic
1167477405 19:49709047-49709069 TGGGATTGGCAGTGGGAGGACGG - Intronic
1167878036 19:52430485-52430507 TGTGATCCACAGAGGGCTGAGGG + Intronic
1167893694 19:52563426-52563448 TGGAGTCTGCAGTGGGAGGATGG + Intronic
1167932609 19:52878787-52878809 TGGAGTCTGCAGTGGGAGGATGG - Exonic
1168277928 19:55287329-55287351 GGTAACCTGGAGAGGGAGGATGG - Intronic
1168634144 19:57982252-57982274 TGAGCTTTGCAGATGGAGGAAGG - Intronic
925053476 2:835559-835581 GGTTATGGGCAGAGGGAGGAAGG + Intergenic
925063889 2:914498-914520 TGTGATCAGGAGAAGAAGGAAGG - Intergenic
925135210 2:1522043-1522065 TGGGGTCAGGAGAGGGAGGAAGG - Intronic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925550205 2:5065535-5065557 AGTGATCTACACAGGGAGGAGGG - Intergenic
926075624 2:9940754-9940776 TGTGAACTGCTGTGGCAGGATGG - Intergenic
926446466 2:12948511-12948533 TGTGATCTGGAGCAGGAGGAGGG + Intergenic
927523692 2:23718833-23718855 TGTGATCTGAAGATGGAAGAAGG - Intergenic
927686720 2:25176265-25176287 TGTGTCCTACAGAGGGAGTACGG - Intergenic
928051834 2:28006211-28006233 TATGAACTGCAGAGGAAGAAAGG - Intronic
928369470 2:30730859-30730881 TGAGGTCTTCCGAGGGAGGAGGG - Intronic
928590446 2:32809371-32809393 CGTGAACTGCAGGGAGAGGATGG - Intronic
929826766 2:45314991-45315013 TGTGGTCTGAAGAGGAAAGAAGG + Intergenic
929909976 2:46081613-46081635 TGAGATCTGAAGGGTGAGGAGGG + Intronic
930753066 2:54950604-54950626 TGTGACCCTCAGAGGAAGGAAGG - Intronic
931673810 2:64673217-64673239 TGTGCTCTGAAGATGCAGGAAGG - Intronic
931982164 2:67705422-67705444 TGAGACCTTCAGAGGGAGTATGG + Intergenic
932284404 2:70520182-70520204 AGTGATTTCCAAAGGGAGGAGGG - Intronic
932563733 2:72892876-72892898 TGTGCTCAGCAGAGGGCGCATGG + Intergenic
932708959 2:74048011-74048033 TGTCATCGGCAGGGGGAAGAGGG - Exonic
932816701 2:74867619-74867641 CGTGTTCTGCAGAGAAAGGAAGG - Exonic
933389517 2:81652474-81652496 TCTGCTCAGCAGAGAGAGGATGG - Intergenic
933783689 2:85820562-85820584 TGTGAAGTGGTGAGGGAGGAAGG + Intergenic
934474538 2:94585736-94585758 TAGAATCTGCAGAGGGAGGCCGG + Intergenic
934556609 2:95289895-95289917 TGAGATCTGCAGAGGGCCCAAGG - Exonic
934686032 2:96322250-96322272 AGTGATCTTCTGAGGGTGGAGGG - Intergenic
935280320 2:101511735-101511757 TGGGGACTACAGAGGGAGGAGGG + Intergenic
936069178 2:109353902-109353924 TCTGAACTCCAGAGGGAGGCAGG - Intronic
937476582 2:122220496-122220518 TATCATCTGCTGAAGGAGGAGGG - Intergenic
937530608 2:122822731-122822753 TGAGATCTACAGAGGCAGAAAGG - Intergenic
937903744 2:127041627-127041649 TGTGACCTGCAGGGGGTGGCTGG - Intergenic
938376268 2:130808710-130808732 AGTGATCTGCAGAGGCAGAGTGG - Intergenic
939619860 2:144405512-144405534 TGTGACATTCAGAGGGTGGAGGG - Intronic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939820892 2:146955666-146955688 TGAGATCCTCAGAGGTAGGAGGG + Intergenic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
941653054 2:168114222-168114244 TGTGCTCTACAGAGACAGGAAGG + Intronic
941853280 2:170205767-170205789 TTTGGTCAGCAGATGGAGGATGG - Intronic
941857045 2:170241921-170241943 TGTGAGATGCAGAGGCAGCAGGG + Intronic
941918562 2:170828126-170828148 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918600 2:170828294-170828316 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918620 2:170828383-170828405 TGGGGACAGCAGAGGGAGGAGGG - Intronic
941918628 2:170828406-170828428 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918675 2:170828620-170828642 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918681 2:170828643-170828665 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918715 2:170828779-170828801 TGAGGACAGCAGAGGGAGGAGGG - Intronic
943329966 2:186547266-186547288 TGTGCTTTGCAGATGGAAGAAGG - Intergenic
943334719 2:186599907-186599929 TGTGATCTGCAGTAAGAGGGTGG - Intronic
943645577 2:190405949-190405971 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
944903416 2:204238808-204238830 TGTGGTTTGAAGATGGAGGAGGG + Intergenic
946796749 2:223362539-223362561 TGTGATCTGCCTAGGGTGGTGGG - Intergenic
947451847 2:230215942-230215964 TGTGATCTGAAGAGGGAGTTGGG + Intronic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
947859416 2:233348245-233348267 GGTGAACTGCAGGTGGAGGAGGG + Intergenic
948021776 2:234739074-234739096 CCTGAACTGCAAAGGGAGGAGGG - Intergenic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
1170523687 20:17215312-17215334 CCTGGTCTGCAGAGGCAGGAAGG + Intergenic
1171265640 20:23769855-23769877 TGTGATTAGCAGAGGAAAGAAGG + Intergenic
1172119027 20:32586774-32586796 TGTGAAATGCAGAGAGAGGTTGG - Intronic
1172309508 20:33906880-33906902 TGTAGTCTGCAGAGAGAGGCAGG - Intergenic
1172654543 20:36528773-36528795 TGTGATCTGGGGCGGGAAGATGG + Intergenic
1173058231 20:39636659-39636681 TGTCATCTGCAGAATGAGAATGG - Intergenic
1174104084 20:48149707-48149729 GGTGAACTGGAGAGGGAGGTGGG + Intergenic
1174124813 20:48296548-48296570 TGTGATTCTCAGAGGGAGGGAGG + Intergenic
1174284945 20:49465813-49465835 TGAGATCTGAAGAAGGAGAAGGG + Intronic
1174865316 20:54130230-54130252 TTAGAAATGCAGAGGGAGGATGG + Intergenic
1174923218 20:54727415-54727437 AGTGCTCTGGAGAGGGAAGATGG - Intergenic
1175391339 20:58629321-58629343 TGTCATCTGCAGAGGCTGGCTGG - Intergenic
1175526779 20:59639703-59639725 TGGGTACTGCTGAGGGAGGAGGG + Intronic
1175771860 20:61629054-61629076 TCTGATCTGCACAGGCAGGCAGG + Intronic
1175961427 20:62638695-62638717 TGGGAGATGCAGAGGGAGGGCGG + Intergenic
1175989842 20:62782965-62782987 TTTGCTCTGAAGATGGAGGATGG + Intergenic
1176192441 20:63818421-63818443 TCAGTTCTGCAGAGGGAGGGTGG + Intronic
1176711390 21:10152769-10152791 TGTGAGTTGCAGAGGGAGACTGG + Intergenic
1176964205 21:15193657-15193679 TGGAATCTGGTGAGGGAGGAGGG + Intergenic
1178362377 21:31959210-31959232 TGTTTTGTGCAGAAGGAGGAAGG - Intronic
1178574335 21:33771577-33771599 TGTGATCTCCATAGGGATCAGGG + Intronic
1179501198 21:41810057-41810079 GGGGGTCTGCAGAGGGAGGTGGG + Intronic
1179522944 21:41957078-41957100 TGTCTTCTGCAGTGGGAGAAGGG - Intergenic
1179831573 21:44000400-44000422 TGATCTCTGCAAAGGGAGGAGGG + Intergenic
1180681912 22:17633952-17633974 GGTGGTGTGCAAAGGGAGGAGGG - Intronic
1180872059 22:19151743-19151765 GGAGGTCTGCTGAGGGAGGAGGG - Intergenic
1181086105 22:20440113-20440135 TCTGGTCTGCAGGGGCAGGAAGG - Intronic
1181403758 22:22667504-22667526 TGTGAGCTCCAGAGGGTGGGTGG - Intergenic
1181470579 22:23136876-23136898 TAAGATCTGCAGAGTGAGGCTGG + Intronic
1181685566 22:24525450-24525472 TGTGGTCTGCTGAGGCAGGATGG - Intronic
1181704968 22:24644489-24644511 TGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1181980113 22:26760219-26760241 TGTCATCTGGAGGGGCAGGAGGG - Intergenic
1182692445 22:32173531-32173553 TGTGAGCAGCAGAGAGAGAATGG - Intergenic
1182713820 22:32339594-32339616 AGTGGTTTGCAGAGGGAGGTGGG + Intergenic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1184401117 22:44275165-44275187 AGTGGTTTGCAGAGGGAGGTGGG + Intronic
949770957 3:7577678-7577700 TGTCATCTGCAAATGGGGGATGG + Intronic
949999816 3:9648475-9648497 TGTGAGCAGCAGGGGGAGAAAGG + Intergenic
950101582 3:10360118-10360140 TGGGGGCTGCAGAGAGAGGAAGG + Exonic
950106629 3:10392810-10392832 TGTCATCTGTAGAGTGGGGAGGG + Intronic
950358575 3:12433634-12433656 TGTGGTCAGCTGAGGGAGCATGG - Intronic
950461515 3:13124990-13125012 TGTGGACTGGAGAAGGAGGATGG - Intergenic
952816994 3:37454175-37454197 TGTGATCTGCAGGCTGAGGCTGG + Intronic
953978210 3:47398668-47398690 TGGGGGCTGCAGTGGGAGGATGG - Intronic
954163855 3:48740514-48740536 GCAGTTCTGCAGAGGGAGGAAGG + Intergenic
954333096 3:49901189-49901211 TGTACTCAGCAGAGGGAGGGAGG + Intronic
954580320 3:51699689-51699711 TATGCTTGGCAGAGGGAGGAAGG + Intronic
955882744 3:63565200-63565222 TGTCCTATGGAGAGGGAGGAGGG + Intronic
956039627 3:65132345-65132367 TGTGATTTGCAGATGGAGGTTGG + Intergenic
956775518 3:72562230-72562252 TGTGCTGTGAAGATGGAGGAAGG + Intergenic
957156363 3:76550500-76550522 TGTGCTCTGCAGGGCCAGGAGGG + Intronic
958958680 3:100488630-100488652 TGTGATATACAGAGGAAAGAGGG - Intergenic
960446508 3:117756077-117756099 TTTGAGCTGAAGAGGAAGGATGG - Intergenic
960991577 3:123314978-123315000 TGTGATCTGCACCTGAAGGAGGG - Intronic
962733706 3:138305426-138305448 TGTTACTTGAAGAGGGAGGAAGG - Intronic
963249760 3:143092276-143092298 TGGCAGCTGCAGAGGGAGAAAGG + Intergenic
964411485 3:156402540-156402562 TCTGTTCTGCAAAGGGAGAAAGG - Intronic
965317052 3:167205246-167205268 TGGGAGATGCAGAGGGAGAAGGG + Intergenic
965942323 3:174200049-174200071 TGTGATCAGCAGTGGGATGCTGG + Intronic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
966494943 3:180569317-180569339 TGTGATGAGCAGAGGAAGCAGGG - Intergenic
966682687 3:182660025-182660047 TGTGATTTAGAGAGGGAGAATGG - Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967816251 3:193800866-193800888 TGTGATCTGCAGATTGTGAAGGG + Intergenic
967840072 3:193998009-193998031 TATGAACAGCAGAGGGAGGAGGG + Intergenic
967931455 3:194693374-194693396 TGTGAACTGGAGAAGGAGGAAGG - Intergenic
968289233 3:197525906-197525928 AGAGACCTGCAGAGGGAGCACGG - Intronic
968518211 4:1023624-1023646 TGTCATCTGCAGAGAGACGGAGG - Exonic
968655363 4:1776240-1776262 TGTGGTGTGCATGGGGAGGATGG + Intergenic
969352110 4:6603963-6603985 TCTGATTTGGAGAGGGAGGCTGG - Intronic
969968201 4:11018523-11018545 TGTGCTCTTTAGAGAGAGGATGG + Intergenic
970275204 4:14392177-14392199 TGAGATCTGAAGAAGGAGCAGGG - Intergenic
970382932 4:15526101-15526123 TGGGATGTGCAGAGGGAGGTAGG - Intronic
970827150 4:20289806-20289828 TGTGACCTACAGAGGTTGGAGGG + Intronic
971325313 4:25638670-25638692 TGTGAGGGGCAGAGGGGGGAAGG + Intergenic
971756779 4:30717788-30717810 TATGGTCTGGAGAGGGAAGAGGG + Intergenic
972275724 4:37555853-37555875 TGAGATGTGAAGAGGGAAGAAGG - Intronic
973047630 4:45554213-45554235 TGTGATCTGCAGAGGAAAAAGGG - Intergenic
973184665 4:47311515-47311537 TGTGCTTTGAAGATGGAGGAAGG + Intronic
973634883 4:52852611-52852633 TGTGAACTGGAGAGAAAGGATGG + Intergenic
976364838 4:84221830-84221852 TGTGAAATGCAGAGGGAAGTGGG + Intergenic
977235425 4:94502363-94502385 TGTTATCTCAGGAGGGAGGATGG + Intronic
977722361 4:100254449-100254471 TGACACCTGCAGAAGGAGGAAGG + Intergenic
977809627 4:101345723-101345745 TGGGATGTGCGGAGTGAGGAAGG - Intronic
981743170 4:148024362-148024384 TGAGATTAGCAGAGTGAGGAAGG + Intronic
982764908 4:159335198-159335220 GGTGATGTGCATAGAGAGGAAGG + Intronic
984499572 4:180542187-180542209 TTTTATCTGCAGTGGGAGAAAGG - Intergenic
984645008 4:182209882-182209904 AGTCATCTGCAGGGGGAGGTGGG + Intronic
984836566 4:184027955-184027977 TGTGAGGTTCAGAGGGAGGAGGG + Intergenic
985005420 4:185530462-185530484 TGTGCTCTGCATAGGAAGGAGGG + Intronic
985487236 5:158510-158532 TGGGATGGGCAGAGGGAGGAGGG - Intronic
985814246 5:2114844-2114866 AATGATCTGCAGAGGGAGGCAGG - Intergenic
986192209 5:5508151-5508173 GGGGAACTGCAGAGGGAAGAGGG - Intergenic
986293680 5:6420187-6420209 TGGCATCTTCAGAGGGAGCATGG - Intergenic
987933121 5:24427945-24427967 TCTGATCTGCAGAGAAAGTAAGG - Intergenic
987961039 5:24809146-24809168 TGTATTATGCAGAGGGAGAAAGG + Intergenic
988486929 5:31675026-31675048 TGGGATCTGAGGAGAGAGGATGG + Intronic
990651882 5:57909506-57909528 TGTGATCTCCAGAAGAAGCAGGG - Intergenic
991408190 5:66321897-66321919 TTTGGTCTTCTGAGGGAGGATGG - Intergenic
992257002 5:74931007-74931029 TGGAGTCTGCAGTGGGAGGATGG + Intergenic
992768431 5:80024591-80024613 TATGATCTGGAGAGGCAGCACGG - Intronic
993064779 5:83083959-83083981 TGTAAAATGCAGAGGTAGGAAGG - Intronic
994515560 5:100768605-100768627 TGTGATACGGAAAGGGAGGAAGG + Intergenic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
995050355 5:107696481-107696503 TGAGATCTGGAGAGAGAAGAGGG + Intergenic
996147511 5:119993862-119993884 GCTGATCTGCAGAGAAAGGAGGG - Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
998934840 5:147224109-147224131 TGTGATCTGCAAAGAGCAGAAGG + Intergenic
999109914 5:149110196-149110218 TGTGATGCGCAGATGGTGGAAGG - Intergenic
999566819 5:152873114-152873136 TGTGTGCTTCAGAGTGAGGATGG - Intergenic
999690598 5:154142821-154142843 TGTGCTTTGAAGAGGGAGGACGG - Intronic
1000019880 5:157309912-157309934 AGGGATCTGGGGAGGGAGGAGGG - Intronic
1000249899 5:159483952-159483974 TTTGTTCTGCAGAAGGAGAATGG + Intergenic
1001421322 5:171589428-171589450 TGTGAGAAGCAGAGGTAGGAGGG + Intergenic
1001658562 5:173373269-173373291 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1003171569 6:3725230-3725252 TGTGATCTGGGCAGGGAGGACGG - Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003520493 6:6854545-6854567 AGTGGTCTGCAGAGAGAGGAAGG - Intergenic
1003751928 6:9068640-9068662 TGTGAGATGCAGGGGGATGATGG - Intergenic
1004407932 6:15351870-15351892 TGTCATCAGCAGAGGGAAGCGGG - Intronic
1005010648 6:21332250-21332272 TGTGGTCAGCAGAGGTAGCAAGG + Intergenic
1005497818 6:26404118-26404140 CAAGATCTGCAGAGGGAGGTGGG - Intronic
1006162452 6:32046453-32046475 GGAGCTGTGCAGAGGGAGGAGGG + Intronic
1006366423 6:33618842-33618864 TGTTTTCTGCAGAGGGTGGGAGG + Intergenic
1007307903 6:40921488-40921510 AGAGCCCTGCAGAGGGAGGAAGG + Intergenic
1007794517 6:44337053-44337075 TGTGAACTGGAGAGGAAAGAGGG - Intronic
1007892539 6:45308592-45308614 TGGGATCGGGGGAGGGAGGAGGG + Intronic
1010857843 6:80864557-80864579 TGTAATCTGCAGCTGTAGGATGG - Intergenic
1012468941 6:99548280-99548302 TGGGATCTGCATAGGTAGGAAGG - Intronic
1013015770 6:106159491-106159513 TCTGATCTGCAGTGTGGGGAAGG + Intergenic
1013394638 6:109722929-109722951 TGGGAGCTGGAGAGAGAGGAAGG + Intronic
1013820221 6:114145715-114145737 TGCGAACTGCAGTGGGAGGCAGG + Intronic
1014850561 6:126335326-126335348 TGTGTTTTTAAGAGGGAGGAAGG + Intergenic
1016312123 6:142745538-142745560 TGTGATTGGCAGAGGGAGGAGGG + Intergenic
1016876701 6:148872785-148872807 TGTGTTTTGCAGATGGAGGAAGG - Intronic
1016948016 6:149551945-149551967 TGTGATAGGCAGAGGCAGAATGG + Intergenic
1017194755 6:151687211-151687233 TGTGATCTGAAGTGGGCGTAGGG + Intronic
1017986330 6:159446011-159446033 TGTGATCTGCAGGTAGTGGAAGG - Intergenic
1018172095 6:161151535-161151557 TGAGATGTGCAGTGGGAGGCAGG + Intronic
1019014497 6:168870087-168870109 TCTGAACTCCAAAGGGAGGAGGG - Intergenic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019581467 7:1765647-1765669 TGGGCTCTGAAGATGGAGGAAGG + Intergenic
1019778115 7:2924360-2924382 TGTCATCTGCAGAGGGACGAGGG + Exonic
1020700082 7:11469855-11469877 TATGGTCTGCAGAGTTAGGAAGG - Intronic
1021959478 7:25857913-25857935 AGAGATCTGCATGGGGAGGAGGG + Intergenic
1022177403 7:27885006-27885028 TCTGCTCTGCACAGGAAGGAGGG + Intronic
1022184971 7:27958508-27958530 TGTGTGCTGCAGAGGGAACATGG + Intronic
1022205883 7:28163303-28163325 TGTGATATACAGTGGGAGAAAGG + Intronic
1022831853 7:34075645-34075667 CGTGATAGGCAGAGGGAGGGAGG - Intronic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024883088 7:54111768-54111790 TGGGATGTGCAGAGACAGGAAGG - Intergenic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1026829868 7:73603882-73603904 TGTGGTCAGGAGAGGGAGGCAGG + Intronic
1027172372 7:75881812-75881834 TGTAAACTGCAGAGGGAGTCGGG - Exonic
1028550444 7:92056316-92056338 TGTAGTTTGCAGAGGGAGCAGGG + Intronic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1030150291 7:106397784-106397806 TGTGATCTAGAGAGAGAAGAGGG + Intergenic
1030301057 7:107975487-107975509 TGTGAGATTTAGAGGGAGGAAGG - Intronic
1032548997 7:132766886-132766908 GGTGAGCTGCAGCAGGAGGAGGG + Intergenic
1032597137 7:133253179-133253201 TGTGATCAGGTGAGGGAGGCAGG + Exonic
1033132820 7:138759844-138759866 TGTGATCAACAGGGAGAGGATGG - Exonic
1033323468 7:140360850-140360872 TGTGAGCTTCAGAGGGAGATGGG - Intronic
1034534017 7:151715689-151715711 TGTGATCTAGAAAGGGAGGATGG + Intronic
1034721288 7:153295791-153295813 TGAGGTCTGCAGAGGGAGAGAGG + Intergenic
1035732490 8:1862702-1862724 TGTGTTTTGCAGAGGGACAAAGG - Intronic
1035931082 8:3780866-3780888 TGAGATTTGCAGAGTGTGGAAGG + Intronic
1035953228 8:4047262-4047284 TGTATTCTGGAGTGGGAGGAAGG + Intronic
1036705312 8:11042135-11042157 TGTGATGTGAAGAGTGAAGAAGG - Intronic
1037789057 8:21920190-21920212 TGTTATCTGCTGAGGGATGGCGG - Intronic
1038045914 8:23765481-23765503 TGTGAGCTGCCGAGGAAAGAAGG + Intergenic
1039150004 8:34493868-34493890 TGAGATGTTCAGTGGGAGGATGG + Intergenic
1039366877 8:36937618-36937640 TGTGCTCAGGGGAGGGAGGAGGG + Intergenic
1039951826 8:42178991-42179013 TGTGATGTGCAGCGGCTGGATGG + Exonic
1040383376 8:46894474-46894496 TGGCATCTGCAGAGGCAGGTGGG - Intergenic
1040902735 8:52433564-52433586 TGTGCTTTGAAGATGGAGGAGGG - Intronic
1040975389 8:53188387-53188409 TGTTATCAGCAGAGGAATGATGG - Intergenic
1041403700 8:57472951-57472973 TGAGATCTGCAAAGGGAAAAGGG + Intergenic
1041772006 8:61481739-61481761 TGGAATCTACAGAGGGAGGCAGG - Intronic
1042846039 8:73170420-73170442 TGTGATATGAGGAAGGAGGAAGG - Intergenic
1043088242 8:75864998-75865020 TGTGTTTTGCAGACGGAGGCAGG - Intergenic
1043447950 8:80337836-80337858 TGTGGTATTCTGAGGGAGGAAGG - Intergenic
1043779912 8:84319511-84319533 TGTGATATTCAGACAGAGGAAGG + Intronic
1044064587 8:87683883-87683905 TGTGTTGTGCAGAGGAAGGGAGG + Intergenic
1044150332 8:88769040-88769062 TGTGATGTGCAAAGGAAGGGAGG - Intergenic
1044776466 8:95693878-95693900 GGCGGACTGCAGAGGGAGGAGGG - Intergenic
1045013990 8:97982912-97982934 TGTGGTCTGGAGAGGCAGGAAGG - Intronic
1045291657 8:100838441-100838463 TGTGCTCTGAAGACGGAGAAAGG + Intergenic
1045650623 8:104338843-104338865 CGTGAACTGGAGTGGGAGGAGGG - Intronic
1048054990 8:130854847-130854869 AGTGACCTACAGAGGGAGGGAGG - Intronic
1049044103 8:140136102-140136124 AGTGATTTGGAGAGGGAGGTAGG + Intronic
1049343226 8:142124861-142124883 TGGGAGCTTCAGAGGGAGCAAGG + Intergenic
1049408137 8:142460733-142460755 TCTGGCCTGGAGAGGGAGGAGGG - Intronic
1049452808 8:142671283-142671305 TGTGCTTTGAAGATGGAGGAAGG + Intronic
1049707695 8:144050522-144050544 GGTGGTCTGCAGAGAGAGGCGGG - Intergenic
1049742631 8:144248436-144248458 TGTCTCCTGCAGAGGAAGGAGGG + Intronic
1050063214 9:1731955-1731977 TGTGTTGTGGAGAGGGGGGATGG - Intergenic
1050317327 9:4416045-4416067 TGTGCTCTGCAAAGTGAGGTCGG - Intergenic
1051097863 9:13487185-13487207 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1051565173 9:18489251-18489273 TTTGATTTTCACAGGGAGGAAGG - Intronic
1052855516 9:33404014-33404036 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1053564696 9:39236854-39236876 AGAGATCTGCAGAGCCAGGAAGG + Intronic
1053683528 9:40500366-40500388 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1053933510 9:43128684-43128706 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1054132456 9:61382180-61382202 AGAGATCTGCAGAGCCAGGAAGG - Intergenic
1054280187 9:63124555-63124577 TAGAATCTGCAGAGGGAGGCCGG + Intergenic
1054296632 9:63335863-63335885 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1054394649 9:64640369-64640391 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1054429297 9:65145569-65145591 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1054501086 9:65875962-65875984 TAGAATCTGCAGAGGGAGGCCGG + Intergenic
1054928806 9:70615367-70615389 TTTGTTCTGCAGAGGGAAGGGGG - Intronic
1054960348 9:70961186-70961208 TGTGCTTTGAAGATGGAGGAAGG + Intronic
1056289572 9:85129078-85129100 TGTGAATTGCAGGGGGAGGTGGG - Intergenic
1056450383 9:86710962-86710984 AGTGATCTGCAGAGCCAGGCTGG + Intergenic
1056523927 9:87425273-87425295 TGAGATTTGCAAAGGAAGGAGGG + Intergenic
1056780382 9:89544602-89544624 TGTGATCTGGAGAGGGAGGCAGG - Intergenic
1056796295 9:89660949-89660971 GGTGACCTCCAGAGGGAGAAGGG + Intergenic
1058441992 9:105017920-105017942 TGTGCTTTGAAGATGGAGGAAGG - Intergenic
1059443674 9:114325032-114325054 TGTCAGCTGCAGGGGGAGCAAGG - Exonic
1059444874 9:114331809-114331831 TGTCAGCTGCAGGGGGAGCAAGG - Exonic
1060239449 9:121890289-121890311 TGTGAACTGCAGTGACAGGAGGG - Intronic
1061006596 9:127931574-127931596 TGTGATCAGGAGTGGGGGGAGGG - Intergenic
1061079668 9:128362303-128362325 TGTGATCAGCAGAGGGCGTGTGG + Intergenic
1061808946 9:133151442-133151464 TGTGCTCTGCACAGGGTGGGAGG - Intergenic
1061974581 9:134061852-134061874 TGTGATCGGCTGTGGCAGGAGGG + Intronic
1062182420 9:135197730-135197752 TGTCATCTTCACAGGGAGGTGGG - Intergenic
1202796143 9_KI270719v1_random:121758-121780 TGTGAGTTGCAGAGGGAGACTGG + Intergenic
1185632220 X:1523511-1523533 TGTGATTGCCAGAGGGAGGAGGG + Intronic
1185926123 X:4148917-4148939 TGAGATCTGCAGAGGAAAAAGGG + Intergenic
1186288840 X:8074434-8074456 TGTGAACTGCAGATGGAGAGAGG - Intergenic
1186735840 X:12463070-12463092 TGTGGTAAGCTGAGGGAGGATGG + Intronic
1186807731 X:13156565-13156587 TATGCTTTGCAGATGGAGGAAGG + Intergenic
1187402807 X:18976790-18976812 AGGGATCAGGAGAGGGAGGAGGG - Intronic
1190243500 X:48676103-48676125 TTTGATCTGCAGGAGTAGGACGG - Intergenic
1190308525 X:49100872-49100894 TTTGATCTGCAGGAGTAGGACGG - Intronic
1194613237 X:96070025-96070047 TGTGACTTGCAGAAGGAGAAAGG - Intergenic
1195087403 X:101425368-101425390 TGTGGTTAGCAGAGAGAGGAAGG + Intronic
1197116237 X:122836952-122836974 TGTGCTTTGCAAATGGAGGAAGG + Intergenic
1197986371 X:132270165-132270187 TGGGATGTTCAGAGGGAGCAGGG - Intergenic
1198147164 X:133868784-133868806 TGTTATCAGCAGAGGAAGGGAGG - Intronic
1199215892 X:145259971-145259993 TGTGAAATGCATAGGAAGGAGGG - Intergenic
1199371371 X:147053410-147053432 TGTCATCTGCAGACGGAGACAGG - Intergenic
1199681612 X:150228489-150228511 TGTGCTTTGAAGATGGAGGAGGG - Intergenic
1199874702 X:151920808-151920830 TGAGATCGGCAGAGGGAAGGTGG + Intronic
1200238256 X:154479447-154479469 TGCGATTCGCAGAGGGAGGGTGG + Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201741493 Y:17328598-17328620 GGTGATAGGCAGAGGTAGGATGG + Intergenic