ID: 997826562

View in Genome Browser
Species Human (GRCh38)
Location 5:137111913-137111935
Sequence AGGGATTCACAGATGAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 263}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997826562_997826576 24 Left 997826562 5:137111913-137111935 CCCCCATTCATCTGTGAATCCCT 0: 1
1: 0
2: 2
3: 25
4: 263
Right 997826576 5:137111960-137111982 GCCTTATTTGGGGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 141
997826562_997826574 13 Left 997826562 5:137111913-137111935 CCCCCATTCATCTGTGAATCCCT 0: 1
1: 0
2: 2
3: 25
4: 263
Right 997826574 5:137111949-137111971 AAAAGAACAGTGCCTTATTTGGG 0: 1
1: 0
2: 6
3: 31
4: 374
997826562_997826573 12 Left 997826562 5:137111913-137111935 CCCCCATTCATCTGTGAATCCCT 0: 1
1: 0
2: 2
3: 25
4: 263
Right 997826573 5:137111948-137111970 GAAAAGAACAGTGCCTTATTTGG 0: 1
1: 0
2: 1
3: 17
4: 241
997826562_997826578 25 Left 997826562 5:137111913-137111935 CCCCCATTCATCTGTGAATCCCT 0: 1
1: 0
2: 2
3: 25
4: 263
Right 997826578 5:137111961-137111983 CCTTATTTGGGGCCTGTGCAGGG 0: 1
1: 0
2: 2
3: 11
4: 124
997826562_997826575 14 Left 997826562 5:137111913-137111935 CCCCCATTCATCTGTGAATCCCT 0: 1
1: 0
2: 2
3: 25
4: 263
Right 997826575 5:137111950-137111972 AAAGAACAGTGCCTTATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997826562 Original CRISPR AGGGATTCACAGATGAATGG GGG (reversed) Intronic
900869239 1:5289973-5289995 ATGGATACATGGATGAATGGTGG + Intergenic
901356013 1:8649800-8649822 AGGAATTCAATGATGAGTGGGGG + Intronic
902425840 1:16321154-16321176 AGGGTGTAACAGTTGAATGGTGG - Intronic
903580018 1:24363912-24363934 AGGAAATCACTGGTGAATGGAGG - Intronic
904176986 1:28637079-28637101 AGAGATTAACAGAAGAATGGTGG + Intronic
904262499 1:29297755-29297777 TGGGATTCACTGATGAGTTGGGG + Intronic
905898649 1:41566206-41566228 AGTCATTCACAAATGCATGGTGG + Intronic
906161345 1:43651061-43651083 AGGCATACAAAGATGAATAGGGG + Intronic
906607213 1:47180974-47180996 AGGGAGACAGAGATGGATGGAGG + Intergenic
906888514 1:49680433-49680455 AGGCACTCTCAGATGAATGAAGG - Intronic
909952148 1:81733630-81733652 AGGTATTAACATATGAATGTGGG + Intronic
912186941 1:107288679-107288701 AAGGATTGACAAATGAGTGGGGG + Intronic
916671369 1:167024237-167024259 AGGAACTCACAGTTTAATGGGGG + Intergenic
917932446 1:179832345-179832367 AGGGGTTCACAGATGCATTTGGG - Intergenic
918465573 1:184818454-184818476 ATGAATAGACAGATGAATGGTGG + Intronic
919510020 1:198450464-198450486 AGGGATACTCCTATGAATGGGGG + Intergenic
921707267 1:218337479-218337501 AGGAATTGACAGAAGACTGGTGG - Exonic
922792839 1:228319642-228319664 ATGGATGGATAGATGAATGGTGG - Intronic
922911259 1:229219697-229219719 AGAGATTCAAAGTAGAATGGTGG + Intergenic
1065126874 10:22582382-22582404 AGAGATTCACAGCTGACTGAAGG + Intronic
1067045982 10:42985437-42985459 GGGCTTTCACATATGAATGGGGG + Intergenic
1067228785 10:44392555-44392577 AGGGGTGCACGGATGAATGGAGG - Intergenic
1068219209 10:54021939-54021961 ATTAATTGACAGATGAATGGTGG + Intronic
1068232880 10:54193636-54193658 AGGGATTCTCTGATGTATAGTGG - Intronic
1068729370 10:60338975-60338997 AGAGCTTCACAGATGTTTGGTGG + Intronic
1069532853 10:69231695-69231717 AGGGATGCGCAGATGAAAGACGG - Intronic
1069794425 10:71043100-71043122 AGAGATTCCCAAATAAATGGCGG - Intergenic
1070302976 10:75218414-75218436 TGGGATTCAAAAATCAATGGGGG - Intronic
1071048370 10:81413824-81413846 ATGGATTCACAGTTGAATATGGG - Intergenic
1072966806 10:99980894-99980916 AGAGATTAAAAGCTGAATGGTGG + Intronic
1073249372 10:102112489-102112511 AGGGATGGAAAGATAAATGGGGG + Intronic
1073517291 10:104087852-104087874 AGGGCTTCACATATGAATTTTGG + Intergenic
1073640750 10:105250256-105250278 AAGTTTTGACAGATGAATGGGGG + Intronic
1075139766 10:119821715-119821737 AGGGAGGCAGAGATGAAGGGAGG - Intronic
1076528833 10:131130870-131130892 AGGGATGCAGAGATCACTGGGGG - Intronic
1076594156 10:131615279-131615301 AGGGCTGCACAGGTGTATGGAGG + Intergenic
1076594160 10:131615311-131615333 ATGGATGCACAGGTGTATGGAGG + Intergenic
1077927132 11:6692857-6692879 AGGAATTCACAGGTGTTTGGAGG + Intergenic
1078268695 11:9774703-9774725 AGGGAAGCAAAGATGAGTGGAGG - Intergenic
1079425858 11:20341910-20341932 AGAGATGGACAGAAGAATGGAGG - Intergenic
1079913134 11:26335521-26335543 AGGGATGGACATATGAATTGAGG - Intronic
1080559450 11:33449532-33449554 AGAGAGTCACAGAAGAATGGTGG - Intergenic
1081643152 11:44771463-44771485 AGGCATCAACAGCTGAATGGTGG - Intronic
1081719007 11:45273109-45273131 AGGTATTTACAAATGTATGGAGG + Intronic
1084445072 11:69198877-69198899 AGAGATTGATGGATGAATGGAGG - Intergenic
1085393850 11:76196354-76196376 ATGGATTCATGGATGAATGACGG - Intronic
1085721929 11:78920010-78920032 AGGGGCTCACAGATTAGTGGGGG - Intronic
1085795564 11:79536574-79536596 GGGGAAACCCAGATGAATGGAGG + Intergenic
1086525136 11:87715804-87715826 AGGGAAACAGAGATCAATGGAGG - Intergenic
1087015858 11:93554127-93554149 AGGGAGTGACAGCTTAATGGGGG + Intergenic
1088970021 11:114765691-114765713 AGGTATACACAGATGAAAGTAGG - Intergenic
1091008200 11:131973455-131973477 AGGGATTCACTGTGGAGTGGAGG - Intronic
1091367634 11:135035750-135035772 ATGGATGCATAGATGGATGGAGG + Intergenic
1092374470 12:7943794-7943816 AGGGATTCACATGTGAATTAGGG - Intergenic
1092510276 12:9147745-9147767 AAGGAGTCATAGAAGAATGGTGG - Intergenic
1093200302 12:16178591-16178613 AGGGAGTGACAGAAGAAGGGAGG - Intergenic
1095976247 12:47942710-47942732 AGGGGTGCACAGGTGTATGGGGG - Intronic
1096806700 12:54145375-54145397 AGGGACAGACAGATGGATGGAGG + Intergenic
1097246202 12:57609133-57609155 AGGGTATCACAGATGACTGAAGG + Exonic
1097518861 12:60643560-60643582 AAGCTTTCACAGATGAATGTTGG - Intergenic
1097738902 12:63215361-63215383 AGGTTTTAACATATGAATGGAGG - Intergenic
1098133612 12:67378068-67378090 AAGGATTCTCAGTTGAATGTTGG - Intergenic
1099633368 12:85178855-85178877 AGGGATACAAAGATGAATATAGG + Intronic
1100276120 12:93073438-93073460 AGGGTTTTAGAGATGGATGGTGG - Intergenic
1100358954 12:93858753-93858775 AGTGTTACACAGAAGAATGGTGG - Intronic
1101004893 12:100391883-100391905 AGGTTTTCTCAGATGAGTGGTGG + Intronic
1101066428 12:101026997-101027019 AAGGATTCACACATTAATGATGG - Intronic
1101281678 12:103263862-103263884 AGGGAATCATTGATGATTGGTGG - Intronic
1101853977 12:108426943-108426965 AGAGAGTCAAAGATGAAAGGTGG - Intergenic
1103064166 12:117883056-117883078 ATGGATGGATAGATGAATGGAGG - Intronic
1103150289 12:118632382-118632404 AGGCACTCACAGAGGGATGGAGG - Intergenic
1104189101 12:126460705-126460727 AAGGATGGACAGATGGATGGAGG + Intergenic
1104766135 12:131331374-131331396 ATGGATGGATAGATGAATGGGGG - Intergenic
1104772588 12:131372866-131372888 AGGGATGGACAGATGGATGGAGG - Intergenic
1104925730 12:132313186-132313208 ATGGATGTACAGATGTATGGAGG - Intronic
1106334605 13:28772261-28772283 AGGTATTCAAATATGAATAGAGG - Intergenic
1106733384 13:32565347-32565369 AGGGACTGAAAGATGAGTGGGGG + Intergenic
1108821601 13:54357533-54357555 AGGGATTCTCAAACGAATGCTGG - Intergenic
1112226266 13:97543660-97543682 AGGGCTTGACAGAGGAAGGGAGG + Intergenic
1112449946 13:99499175-99499197 TGGAATTCACATATAAATGGGGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113562848 13:111297375-111297397 AGGGATACACAAATGTAAGGTGG - Intronic
1114524238 14:23358549-23358571 AGGAATTCACAGTTGGAAGGAGG + Intronic
1114528995 14:23383511-23383533 AGGGATCCACAGAGCAATGAAGG + Intronic
1114741958 14:25106395-25106417 AGGTATTCAAAGATGAAGAGAGG + Intergenic
1116775555 14:49177139-49177161 TGGGATTCACAAATTAATGAAGG + Intergenic
1118174928 14:63429263-63429285 ACAGTTTCACAGATGAAAGGGGG - Intronic
1119050077 14:71358575-71358597 AGGGATTCAGGAATGAATGGAGG - Intronic
1121008058 14:90502935-90502957 AAGGATGCAAGGATGAATGGAGG + Intergenic
1121439671 14:93940759-93940781 AGGATTTCACAGATGAATAGAGG - Intronic
1121813321 14:96910653-96910675 AGGCTTCCACAGATGACTGGGGG + Intronic
1121830827 14:97050737-97050759 TGGGATTCACAAATGAAAGGGGG + Intergenic
1122735760 14:103840171-103840193 AGGGCTAAACAGAGGAATGGTGG - Intronic
1123069071 14:105632345-105632367 AGGGAGACACAGAGGACTGGGGG - Intergenic
1124242961 15:28046423-28046445 AGCCATTCTGAGATGAATGGAGG + Intronic
1124383235 15:29185306-29185328 ATGAATTCAGAGATGCATGGAGG - Intronic
1126296854 15:47148835-47148857 AGGGTTTCAAAGATGCATTGAGG - Intergenic
1126305339 15:47249399-47249421 GGGGATGCAAAAATGAATGGTGG + Intronic
1128734126 15:70042729-70042751 ATGGATGGATAGATGAATGGGGG - Intergenic
1130419123 15:83724723-83724745 GGGGATACACAGTAGAATGGTGG - Intronic
1131212200 15:90507555-90507577 AGGGCTCCACAGAAAAATGGTGG - Intergenic
1131688793 15:94803770-94803792 AGTGCTTCTCAGATGAATGTTGG - Intergenic
1131966363 15:97848171-97848193 CTGGATTCTCAGATAAATGGAGG + Intergenic
1133326855 16:4947177-4947199 AGGGATGAAGAGATGGATGGAGG - Intronic
1134564024 16:15235720-15235742 AGGGCTTCACTGAAGACTGGGGG - Intergenic
1134738470 16:16520975-16520997 AGGGCTTCACTGAAGACTGGGGG + Intergenic
1134929031 16:18191185-18191207 AGGGCTTCACTGAAGACTGGGGG - Intergenic
1135801585 16:25502137-25502159 AGGGATGCAGGGCTGAATGGAGG - Intergenic
1137000669 16:35227517-35227539 ATGGATTCACAGATGGATTCTGG + Intergenic
1138680205 16:58678570-58678592 GAGGATTCCCAGATGAATGCTGG + Intronic
1139853099 16:69962309-69962331 GGGGATGGACAGATGGATGGAGG - Intronic
1139882070 16:70185217-70185239 GGGGATGGACAGATGGATGGAGG - Intronic
1140370439 16:74410288-74410310 GGGGATGGACAGATGGATGGAGG + Intronic
1141134102 16:81454696-81454718 AGGGACTCATAGTTAAATGGGGG + Intronic
1141314301 16:82946204-82946226 ATGGATACATGGATGAATGGAGG + Intronic
1141854847 16:86673943-86673965 AGGGATGAACAGATGGATGGGGG - Intergenic
1141888321 16:86908729-86908751 AGGGATTAACTGAATAATGGAGG + Intergenic
1144164871 17:12600773-12600795 ATGGATTCTCAGATCAATGGGGG + Intergenic
1145070518 17:19801658-19801680 AGTGATTCTCAGCTGATTGGAGG - Intronic
1146437089 17:32860197-32860219 AGGGAATCACAGACAAGTGGAGG + Intronic
1146939193 17:36832296-36832318 ATGGATGGACAGATGGATGGTGG - Intergenic
1149114986 17:53082579-53082601 AGTGTTTCAGAGATGAATAGAGG + Intergenic
1149257743 17:54846162-54846184 AGGGTTGTAGAGATGAATGGTGG - Intergenic
1151596798 17:75082874-75082896 AGGGCTTCTCAGATGACTAGGGG + Intergenic
1152280079 17:79380020-79380042 AGGGACTCAAAGAGGGATGGAGG - Intronic
1153625962 18:7022773-7022795 TGGGATTCCAAGATGAAGGGTGG - Intronic
1153880001 18:9413678-9413700 AGGAATTCAGAGAAGAAGGGTGG + Intergenic
1156039734 18:32807080-32807102 AGAGGTTCATGGATGAATGGAGG - Intergenic
1156471663 18:37380917-37380939 AGGAATTCATGGATGAATGGAGG - Intronic
1156604921 18:38655077-38655099 AAGGATTCAGAGAAGAGTGGCGG - Intergenic
1156683948 18:39621814-39621836 AGGGAATCACAGGAGAATGATGG - Intergenic
1159061661 18:63520449-63520471 AATGAGTCACAGATGCATGGTGG + Intergenic
1159449219 18:68578272-68578294 AGGGTTTCAAAGATGGATGGAGG - Intergenic
1161373121 19:3924720-3924742 TGGGTTTCAGAGATGAACGGAGG - Exonic
1161381980 19:3970493-3970515 AGGGAGTCAGAGATGGTTGGGGG - Intronic
1161652456 19:5493565-5493587 AGGGATTCCCAGGTGACTGAGGG + Intergenic
1161982882 19:7638988-7639010 ATGGATGGACAGATGGATGGAGG - Intronic
1162085902 19:8248974-8248996 ATGAATTAACAGATGAATGATGG + Intronic
1164706487 19:30323924-30323946 AGGGATGGACAGATGGATGGAGG - Intronic
1165759256 19:38310970-38310992 GGGGACTCACAGTTGAGTGGGGG - Intronic
1166843085 19:45710942-45710964 AGGGCTTCACAGCTTTATGGGGG + Exonic
1168454027 19:56491086-56491108 AGGGGTTCCTAGAAGAATGGTGG - Intergenic
925096363 2:1207554-1207576 AGGGATGCAAAGATGATTTGAGG + Intronic
925777025 2:7345806-7345828 ATGGATGGATAGATGAATGGTGG + Intergenic
926572698 2:14546916-14546938 AGGTAATAACAGAAGAATGGCGG + Intergenic
927231781 2:20831003-20831025 AGAGAATCACAGAGAAATGGAGG + Intergenic
927403724 2:22743955-22743977 AGGGATCAACAGATAAAAGGAGG + Intergenic
927931658 2:27049666-27049688 AGGGCTTCACAGAGGAGTTGGGG + Intronic
928096068 2:28405756-28405778 ATGGATTCACAGCTGCATGTTGG + Intronic
932112872 2:69017404-69017426 AGGGATTGGGAGAAGAATGGTGG - Intronic
933487848 2:82946228-82946250 AGGTATTCACATAGGAAGGGAGG - Intergenic
934044862 2:88164620-88164642 ACGGGCTCAGAGATGAATGGTGG + Intergenic
935115975 2:100136597-100136619 ATGGATAAACAGATCAATGGGGG - Intronic
936392286 2:112086546-112086568 AGTGATTCACAGGTGAGAGGAGG - Intronic
937509560 2:122578743-122578765 AGGGTTTAACATATGAATTGTGG - Intergenic
937646991 2:124276667-124276689 AAGGATTTATAGATGAATCGTGG - Intronic
938483219 2:131679409-131679431 TGGGAGTCACAGATGCTTGGAGG + Intergenic
939416012 2:141898222-141898244 AGGGAGGCACAGAGAAATGGTGG - Intronic
941235790 2:162971443-162971465 TGGGATTCAGAGAAGAGTGGTGG - Intergenic
942252873 2:174062599-174062621 AGGCATTAACAGGTGAAAGGTGG + Intergenic
942982153 2:182095464-182095486 AGGGATACAATAATGAATGGTGG - Intronic
944332688 2:198490170-198490192 AGGAATTGAATGATGAATGGTGG - Intronic
946417056 2:219544958-219544980 AGGGATTCAGAGAAGACTTGGGG - Intronic
948392798 2:237624979-237625001 AGGTTTTGACATATGAATGGGGG - Intergenic
1172949669 20:38714740-38714762 AGGCAGGCACAGATGAATGTGGG + Intergenic
1173706495 20:45114224-45114246 AGGGTTGCACAGGTGAATGTAGG + Intronic
1174747032 20:53073273-53073295 AGGGATGGATGGATGAATGGAGG - Intronic
1175188345 20:57194984-57195006 AGGGATTCACTGAGGCATAGAGG + Intronic
1175664578 20:60847545-60847567 AGGGATTCACAAATGCAGGTGGG - Intergenic
1178596881 21:33962376-33962398 AGGCAGTCACAGATGAGTGCAGG - Intergenic
1179343407 21:40533630-40533652 ATGGATGGACAGATGGATGGAGG - Intronic
1180088824 21:45523658-45523680 AGGCAGTCACAGAGGGATGGAGG + Intronic
1181508040 22:23374903-23374925 TGGGAGCCACAGAAGAATGGAGG - Intergenic
1183677278 22:39306661-39306683 ATGGTGTCACAGATGGATGGGGG + Intergenic
1184293215 22:43509060-43509082 AGGGATGGATAGATGGATGGGGG - Intergenic
1184293322 22:43509412-43509434 AGGGATGGATAGATGGATGGGGG - Intergenic
1184293374 22:43509616-43509638 GGGGATGGATAGATGAATGGGGG - Intergenic
950509080 3:13414852-13414874 AGGGACTCACAGTTGATTGCCGG - Intronic
952033304 3:29170679-29170701 AGGGATTTTCAGATGAGGGGAGG + Intergenic
954828680 3:53399244-53399266 ATGGATTAATAGATGGATGGAGG - Intergenic
957317741 3:78589336-78589358 AGAGATTCACAAACAAATGGAGG + Intergenic
959575051 3:107925298-107925320 GGAGACACACAGATGAATGGCGG - Intergenic
960211227 3:114969238-114969260 AGGGGTTGACAGAAGAAAGGAGG + Intronic
962234986 3:133700056-133700078 AGTCATTCACAGATGAGTGTGGG + Intergenic
962319798 3:134381327-134381349 AGGGTTTCACAGAAAAAGGGTGG + Intergenic
963299744 3:143585096-143585118 AGGGATTCTCAGCAAAATGGAGG - Intronic
963864324 3:150344073-150344095 TGGGATTCAAAGATGAATACAGG - Intergenic
964749698 3:160042898-160042920 AGGGATACCCAGATAACTGGTGG + Intergenic
965001026 3:162953626-162953648 AGAGATTCACAGGGGAATGGTGG + Intergenic
965102900 3:164325132-164325154 AGGGATTAACAGAGGAGTGAAGG + Intergenic
965876382 3:173327352-173327374 AGAGGTTCGCAGATGGATGGTGG - Intergenic
966879755 3:184343444-184343466 AGGGAATGAAAGATGAAAGGAGG - Intronic
967766866 3:193290604-193290626 CTGGATACACAGGTGAATGGGGG + Intronic
968444983 4:647698-647720 AGGGCTTCACAGATGCATGGGGG + Intronic
968466965 4:757224-757246 AGGGCTGCACAGATGAACGCGGG - Intronic
969424945 4:7118660-7118682 AGGAATGGAAAGATGAATGGTGG + Intergenic
970585470 4:17510816-17510838 AGGTCTTCAGAGATGCATGGTGG - Intronic
972107211 4:35504151-35504173 AGGGATACAGAGAGGAAGGGAGG - Intergenic
973580276 4:52337824-52337846 AGGGTTTCACATATGAATTTTGG - Intergenic
974218692 4:58935881-58935903 AGGGATTCTTAGATCAATGAAGG + Intergenic
978538834 4:109793878-109793900 AGAAATTCACAGATAAATAGAGG - Intronic
979093033 4:116511516-116511538 AGAGACTCACAGATGACTGAGGG + Intergenic
980911045 4:138994894-138994916 AGGGAACCACAGTTGAATTGTGG + Intergenic
982642624 4:157982203-157982225 AGGGATGGACAGAATAATGGAGG + Intergenic
983795372 4:171855263-171855285 AGGGAGTGAGAGATCAATGGTGG - Intronic
984709694 4:182874992-182875014 AGGGAGTCACCAATGAGTGGAGG + Intergenic
987969305 5:24921489-24921511 AGGAATTTAAAAATGAATGGTGG - Intergenic
990317669 5:54598909-54598931 AGGTATTCAAATATGAAGGGAGG + Intergenic
990754615 5:59055256-59055278 AGGGATTGACAGAGGAAGGGAGG - Intronic
993634604 5:90328221-90328243 ATGGATTCATAGCTGAATTGTGG - Intergenic
994339369 5:98608192-98608214 AGAGAATCACAGATGGATGCTGG + Intergenic
995293471 5:110487937-110487959 AGACATTCAAAGAAGAATGGTGG - Intronic
995346889 5:111131734-111131756 AGGGCTTCCCTGATGAATGGTGG + Intergenic
995485740 5:112638303-112638325 AGGGGTACACAGAAGGATGGAGG + Intergenic
996509008 5:124298328-124298350 ATAGATTGACAGATGCATGGGGG + Intergenic
997826562 5:137111913-137111935 AGGGATTCACAGATGAATGGGGG - Intronic
998522018 5:142809731-142809753 ATGGATGGACAGATGAATGAAGG - Intronic
998590588 5:143473505-143473527 AAGGATTCACAGCGGAAGGGGGG - Intergenic
998801658 5:145875074-145875096 AGATGTTCACAGTTGAATGGAGG - Intergenic
1001330563 5:170759568-170759590 AGGGGTTCACAGACAACTGGAGG - Intergenic
1001517038 5:172363163-172363185 ATGGATGGACAGATGGATGGAGG - Intronic
1001628513 5:173157115-173157137 TGGGATCCAGAGATGAATGAGGG - Intronic
1003330623 6:5125418-5125440 AGGAACTGACAGGTGAATGGGGG - Intronic
1003745988 6:9003061-9003083 AGGCATTCACAAATGAAAGGAGG + Intergenic
1004633428 6:17443611-17443633 AGGAATTCATAGATGAGTGGAGG - Intronic
1005200219 6:23336238-23336260 GGGAAGTCACAGATGAATGTGGG + Intergenic
1005277745 6:24238139-24238161 AGGGATGCAGGGAGGAATGGAGG + Intronic
1005825852 6:29631618-29631640 AGGCATACAGAGAGGAATGGTGG + Intronic
1006285238 6:33088148-33088170 AGGGATTCAACGATGGAAGGAGG + Intergenic
1006425134 6:33958945-33958967 AGGGATCCACAGAGGAAGGGGGG - Intergenic
1009894682 6:69733754-69733776 AGGCATTCATAATTGAATGGTGG - Intronic
1010336324 6:74688028-74688050 AGGGTTTCACATATTTATGGAGG - Intergenic
1011140818 6:84154088-84154110 AGGGAATCAGAAATGAAAGGGGG + Intronic
1011268904 6:85555555-85555577 AGGGATTCCCAGAGGAAAGAAGG + Intronic
1013429054 6:110039879-110039901 AGGGTTTCAGAGAGGACTGGTGG - Intergenic
1015446976 6:133317802-133317824 AGGGATGGATAGATGAACGGGGG - Intronic
1015452870 6:133390876-133390898 AGGGCTTCATAGAAGATTGGGGG + Intronic
1018405517 6:163477729-163477751 AGTGATTCTCAAATGAAAGGTGG - Intronic
1018531153 6:164764549-164764571 AAGGCTTGACAGCTGAATGGAGG - Intergenic
1018585012 6:165348579-165348601 AGCAGTTCACAGATGATTGGTGG + Intronic
1018701954 6:166434220-166434242 ATGCAGTCACAGCTGAATGGTGG - Intronic
1021747029 7:23751930-23751952 AGGGACCCAAAGTTGAATGGTGG + Intronic
1023025264 7:36043996-36044018 AGGGCTTCAGAGATCAATGCAGG - Intergenic
1024014039 7:45294946-45294968 AGGGGTTCCCAGAAGCATGGTGG + Intergenic
1025157443 7:56620997-56621019 CGGGATGGACAGGTGAATGGCGG + Intergenic
1025758324 7:64367118-64367140 CGGGATGGACAGGTGAATGGCGG - Intergenic
1028789637 7:94839093-94839115 AGAGTTACAGAGATGAATGGTGG - Intergenic
1033530383 7:142256971-142256993 AGGGGCTCAAAGAAGAATGGAGG + Intronic
1034160807 7:148993220-148993242 AGGGATGCAGAGGGGAATGGCGG - Intergenic
1035583288 8:753562-753584 AGGGAGGCACAGATGCCTGGGGG + Intergenic
1037718423 8:21419562-21419584 AGGGAATAACTAATGAATGGAGG - Intergenic
1038222585 8:25624779-25624801 AGAGATGGAAAGATGAATGGAGG - Intergenic
1038324461 8:26561960-26561982 ATTGATTCAAAGTTGAATGGTGG - Intronic
1038432727 8:27513030-27513052 AGAAATTCTGAGATGAATGGAGG + Intronic
1039595624 8:38787784-38787806 AGGGAGTCGCAGATGGATGGAGG - Intronic
1040374452 8:46810437-46810459 CGGGATAGACAGGTGAATGGCGG - Intergenic
1043039503 8:75243401-75243423 AGGAATTCACAAATTAATTGTGG + Intergenic
1043291641 8:78609196-78609218 AGGAATTCACAGAAAAAAGGGGG + Intergenic
1046669353 8:117041051-117041073 AGGAATGCACAGATGCATGCTGG + Intronic
1047672116 8:127159338-127159360 AATGATTCACTGAAGAATGGGGG - Intergenic
1048816763 8:138341372-138341394 AGAGATACAAAGTTGAATGGTGG + Intronic
1049350653 8:142162773-142162795 ATGGATTGACAGATGAATGGAGG + Intergenic
1049350705 8:142163038-142163060 ATGGATTGACAGATGGATGGAGG + Intergenic
1049350736 8:142163213-142163235 ATGGATTGACAGATGGATGGAGG + Intergenic
1049350778 8:142163432-142163454 ATGGATTGACGGATGGATGGAGG + Intergenic
1049350840 8:142163774-142163796 ATGGATTGACAGATGGATGGAGG + Intergenic
1049350892 8:142164045-142164067 ATGGATTGACGGATGGATGGAGG + Intergenic
1049405168 8:142449163-142449185 ACGGACACACAGATGAATGGAGG - Intergenic
1049853751 8:144848963-144848985 AAGGGTTCACAGATGAATTGAGG + Intronic
1050625770 9:7502368-7502390 AGGGACTCACAGATGCAGGAAGG + Intergenic
1050811054 9:9748107-9748129 AGTGATTCACTGATGAATGATGG - Intronic
1054765684 9:69040752-69040774 AGGTTTTAACATATGAATGGTGG - Intronic
1055432687 9:76259927-76259949 AGGGCTTCACAGAAGAGAGGCGG - Intronic
1059646572 9:116274004-116274026 AAGGATACACAGTTAAATGGTGG + Intronic
1061325729 9:129862987-129863009 AGGGCTTCGCAGATGAATTTTGG + Intronic
1061425449 9:130495562-130495584 AGGAGTTAACAGGTGAATGGGGG + Intronic
1061856310 9:133443626-133443648 GGGGATTCTCAGAAGGATGGGGG - Intronic
1061919975 9:133777406-133777428 AGGGCTTCACAGATGAGCTGGGG + Exonic
1062125301 9:134857278-134857300 AGCGGTTTACAGATGAATGAGGG + Intergenic
1062552159 9:137093862-137093884 ATGGATTTACAGATGAATTTAGG - Intronic
1185664661 X:1756093-1756115 AGGGGTTCCCAGGAGAATGGAGG + Intergenic
1186742260 X:12530843-12530865 ATGGATGAATAGATGAATGGTGG + Intronic
1187071250 X:15891033-15891055 AAAGAGTCACAGATAAATGGAGG + Intergenic
1187114000 X:16330949-16330971 CTGGATTCACTGATTAATGGTGG - Intergenic
1187715426 X:22097728-22097750 AGGGATGCTCTGAAGAATGGAGG + Intronic
1193401566 X:81051403-81051425 AGAGATTCACATAGGAATCGAGG - Intergenic
1194393314 X:93347431-93347453 AGGGATTCACGGAGGAATCAGGG + Intergenic
1200732775 Y:6760237-6760259 AGGGACTCACAGACTAATAGAGG + Intergenic
1200972192 Y:9164510-9164532 AGGGCTGCACAGATGAAAGTAGG + Intergenic
1201524922 Y:14921930-14921952 AGGAATTCACAAAAAAATGGAGG + Intergenic
1202138838 Y:21699803-21699825 AGGGCTGCACAGATGAAAGTAGG - Intergenic