ID: 997826648

View in Genome Browser
Species Human (GRCh38)
Location 5:137112474-137112496
Sequence GGCTGACTGTGCCACGGGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997826639_997826648 21 Left 997826639 5:137112430-137112452 CCAACCTTGGATGTGTAGGAGTG 0: 1
1: 0
2: 0
3: 14
4: 79
Right 997826648 5:137112474-137112496 GGCTGACTGTGCCACGGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 125
997826643_997826648 -3 Left 997826643 5:137112454-137112476 CCATCTGAGCCGCAGACCATGGC 0: 1
1: 0
2: 0
3: 12
4: 134
Right 997826648 5:137112474-137112496 GGCTGACTGTGCCACGGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 125
997826641_997826648 17 Left 997826641 5:137112434-137112456 CCTTGGATGTGTAGGAGTGGCCA 0: 1
1: 0
2: 0
3: 11
4: 143
Right 997826648 5:137112474-137112496 GGCTGACTGTGCCACGGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997826648 Original CRISPR GGCTGACTGTGCCACGGGAC AGG Exonic
900409306 1:2505611-2505633 GGCTGACCTGGCCACGGCACAGG + Intergenic
902362185 1:15947961-15947983 GACTGACTCTGCCACGGAAAGGG + Intronic
903178334 1:21593406-21593428 GGCCGGCCGTGCCAGGGGACTGG - Intergenic
905174611 1:36127627-36127649 GGCTGAGTGTGCATGGGGACGGG + Intergenic
906211240 1:44013361-44013383 GGCTGTCTGTGGCACGTGGCTGG - Intronic
906517614 1:46448752-46448774 TGCTGACTGTGGCACTGGGCAGG + Intergenic
907069281 1:51519268-51519290 GGCTGACTGGGGCTCGGGGCGGG + Exonic
912009768 1:104945528-104945550 GGCTGACTGCCCCACGGGGATGG - Intergenic
915902110 1:159854782-159854804 GGCTGACTGCGCCGAGGGGCCGG - Exonic
919163598 1:193863593-193863615 GGCTTACAGTGCCACAGGGCTGG - Intergenic
920499229 1:206476045-206476067 GGCTGACAGAGCCATGGGACAGG - Intronic
920970407 1:210738613-210738635 CTCTGATTGTGCCACGGCACCGG - Intronic
1075031064 10:119025201-119025223 AGCTTACTGGGCCTCGGGACAGG - Intergenic
1075798698 10:125138863-125138885 GGCTAACTGTGCAAAGGAACCGG + Intronic
1078510316 11:11979917-11979939 GGCTGACTGTTCCCAGGGCCTGG - Intronic
1078857356 11:15217124-15217146 GGCTCACAGTTCCACAGGACTGG + Intronic
1079364226 11:19795080-19795102 CGCAGACTGTGGCACTGGACAGG - Intronic
1080902660 11:36510362-36510384 GGCGGACTGTGGCGCGGGCCGGG + Intergenic
1081625797 11:44654368-44654390 GGCTGTCTGTGGCACGGTCCAGG + Intergenic
1083741510 11:64713816-64713838 GGCTCACAGTGCCATGGGCCCGG + Exonic
1084447743 11:69213508-69213530 GACTCACTGTCCCACGGGGCTGG + Intergenic
1084470351 11:69355865-69355887 GCCTGACAGTGCCAGGGGCCTGG + Intronic
1085454010 11:76655731-76655753 GGCTGACTGTGACCTGGGAGTGG + Intergenic
1090860071 11:130645099-130645121 GGCTTCCTCTGCCACTGGACAGG + Intergenic
1090893732 11:130950657-130950679 GGCTGACTTTGCAACAGGAGTGG - Intergenic
1103561204 12:121794047-121794069 GGCTGGCTGTGCCTCCGCACCGG + Exonic
1103838995 12:123847552-123847574 GACTGACTGAGCCAGGGCACTGG - Intronic
1108323842 13:49310784-49310806 GACTGACTGTGACAGGGGCCGGG + Exonic
1110621009 13:77595704-77595726 GGGTTACTGTGTCAAGGGACTGG + Intronic
1112740929 13:102472240-102472262 GGCTGCCTGTCCCAGTGGACTGG - Intergenic
1113022716 13:105906181-105906203 GGCTGACTGTGTGACAGGACAGG - Intergenic
1113483876 13:110640788-110640810 GGCTGCCTGGGCTACAGGACCGG - Intergenic
1113730558 13:112638329-112638351 AGCTGACTCTGGCACAGGACAGG + Intergenic
1122792332 14:104189264-104189286 GCCTCACAGTGCCACGGGGCTGG + Intergenic
1124834975 15:33187705-33187727 GACTGACAGTGCCACGGCATGGG - Intronic
1125843617 15:42830027-42830049 TGGTGAATGTGCCTCGGGACTGG + Exonic
1128937698 15:71761865-71761887 GCCTGACTGTGCCAAGGAAGAGG - Intronic
1132069097 15:98759902-98759924 GTCTCACGGTACCACGGGACAGG - Intronic
1132591071 16:726748-726770 TGCTGGCTGAGCCCCGGGACGGG + Intronic
1132613883 16:831034-831056 GGCGTGCGGTGCCACGGGACGGG - Intergenic
1132743575 16:1427690-1427712 GGGTGACAGTGCCACTGCACCGG - Intergenic
1132781990 16:1632364-1632386 TGGTGAGTGTGCCACGGGCCAGG + Exonic
1132881956 16:2166235-2166257 GGATCACTGTGACAAGGGACAGG - Intronic
1139135937 16:64204972-64204994 GGCTGACAGTTCCACATGACTGG + Intergenic
1142185311 16:88692082-88692104 GGCGGGCTGTGCCATGGGGCAGG - Intergenic
1142310950 16:89313239-89313261 GGGTGACTGTGCCATGGGGTGGG + Intronic
1142325189 16:89410372-89410394 GGCTGACTGTACCAAGGAAATGG + Intronic
1148576168 17:48712893-48712915 GTGTGACTGTGCCCCAGGACTGG + Intergenic
1148771835 17:50071892-50071914 GTGTGACTGTGCCAGGGCACAGG - Intronic
1149639420 17:58193289-58193311 TCCTGACTGTGCCCCAGGACTGG + Intronic
1151530018 17:74698218-74698240 AGCTGGCAGTGCCAGGGGACCGG - Intronic
1151654689 17:75490400-75490422 AGCTGGCTGTGCCAGAGGACGGG + Intronic
1152436199 17:80277974-80277996 GGATGGCTGTGCCAAGGGACAGG - Intronic
1152678416 17:81653376-81653398 GGCTGACTGGGACCCGGGCCTGG - Intronic
1157856046 18:51106696-51106718 GGCTCACTGTTCCATGGGTCAGG + Intergenic
1158974265 18:62696681-62696703 GGCTGACTACTCCACTGGACTGG - Intergenic
1160435213 18:78846490-78846512 GACTCACAGTGCCACAGGACTGG - Intergenic
1160757102 19:763581-763603 GGATGACTGAGCCTCGGGATGGG + Exonic
1161889138 19:7021423-7021445 GGCTGTCTGTGCCTCAGGAGTGG - Intergenic
1161892314 19:7049326-7049348 GGCTGTCTGTGCCTCAGGAGTGG + Exonic
1164635079 19:29785949-29785971 AGCTGACTGTGCCATGGGTGTGG + Intergenic
1164676604 19:30105418-30105440 GGCTTGCTGTCCCACAGGACTGG - Intergenic
1167240648 19:48341217-48341239 GGCTGACTCAGCCTCGAGACAGG + Intronic
1168317960 19:55492263-55492285 GGCCGACTGTGCAGTGGGACAGG - Intronic
1168354285 19:55692112-55692134 GGTTGACTGTGCCCTTGGACAGG + Intronic
925020281 2:563067-563089 GGCTGACTGAGGCACAGGTCTGG - Intergenic
926251278 2:11156660-11156682 GGATGACTGTGCCCAGGGCCGGG - Intronic
926887302 2:17609941-17609963 GGCAGGCTGTGCCACTGGACTGG + Intronic
927198750 2:20565612-20565634 TGCTGACTGTCCCACGGGGTGGG - Intronic
927711776 2:25330669-25330691 GGCTCAGTGTGCCAGGGGATAGG - Intronic
927878589 2:26674969-26674991 GGCTGGCTGTCCCCCGGGCCAGG + Intergenic
928247144 2:29640343-29640365 TGCGGACAGTGCCATGGGACCGG - Intronic
933610489 2:84429488-84429510 TGCCCACTGTGCCAGGGGACTGG + Intronic
937750924 2:125475698-125475720 GACTTACTGTCCCACGTGACTGG - Intergenic
938115869 2:128602669-128602691 GGCTGAGTGTGCCTGGGAACCGG + Intergenic
939441920 2:142260819-142260841 GGCTGCCTTTTCCATGGGACTGG - Intergenic
940361865 2:152804792-152804814 GGCACACAGTGGCACGGGACTGG - Intergenic
940978304 2:159972052-159972074 GGTTTCATGTGCCACGGGACTGG + Intronic
945061214 2:205910531-205910553 GGCTGAGTGTGCCAGGAGAAAGG - Intergenic
947907454 2:233775688-233775710 GGCTGCTTGGGCCACGGGAGAGG + Exonic
948015921 2:234690457-234690479 ATCTAACTGTGCCAGGGGACAGG - Intergenic
1169449234 20:5697125-5697147 GCGTGACTTTGCAACGGGACAGG + Intergenic
1175174745 20:57104415-57104437 GAATGACTGTGCCAAGGTACTGG - Intergenic
1176888421 21:14284475-14284497 GGCTGACAGTTCCACAGGGCTGG + Intergenic
1181476126 22:23168795-23168817 TGCTGACAGTGCCCAGGGACAGG - Intergenic
1181531448 22:23519791-23519813 GGCTGGCTGTGTCCCAGGACAGG - Intergenic
949924175 3:9027965-9027987 GATTGACTGTGCCCAGGGACAGG + Intronic
957014272 3:75044490-75044512 GGCTGCCATTGCCACAGGACTGG - Intergenic
959567694 3:107849370-107849392 AGCTGACTGAGCCCAGGGACAGG + Intergenic
962318272 3:134372136-134372158 GGTTGACTGTGCCAAGGCTCTGG - Intronic
963168011 3:142225069-142225091 GGCTGAGGGTGCCAGGGGCCCGG - Intronic
965794962 3:172429814-172429836 GGTTGCCTGTGCCACAGCACTGG + Intergenic
968563093 4:1295426-1295448 GGCTGACTGTGGACCCGGACCGG + Intronic
968844958 4:3035906-3035928 GGCTGACAGTGACACGAGGCAGG - Intronic
969379006 4:6782486-6782508 GGCTGACGGCGCGAGGGGACAGG - Intronic
976475253 4:85475615-85475637 GGCTGCCTGCGCCAGGGGAGGGG + Intronic
977293328 4:95186819-95186841 GGCTGACTGTGGCTGGGGGCTGG - Intronic
980970472 4:139562585-139562607 GGATGACTGTATCACAGGACAGG - Intronic
985833323 5:2251862-2251884 GGCTGACTGGGACACGGCAGGGG - Intergenic
995608010 5:113879217-113879239 GGCTCACAGTTCCACAGGACTGG - Intergenic
997826648 5:137112474-137112496 GGCTGACTGTGCCACGGGACAGG + Exonic
998080756 5:139273463-139273485 GCCTGACTGTGCCATGGTGCAGG + Intronic
998401986 5:141852961-141852983 GGATGACTGTGCCTCTGGCCTGG - Intergenic
999038772 5:148384050-148384072 GGCTGAGTGGGCCTGGGGACCGG + Intronic
1000384058 5:160657070-160657092 AGCTGACTGTGCCAAGGAATAGG + Intronic
1001081479 5:168670923-168670945 GGCTCACTGTGGCTCTGGACAGG + Intronic
1002269060 5:178057871-178057893 TGCCGATGGTGCCACGGGACAGG + Intergenic
1007542254 6:42658280-42658302 TTCTGTCTCTGCCACGGGACTGG - Exonic
1013883569 6:114934108-114934130 GGCTGGCTTTCCCATGGGACTGG - Intergenic
1015855354 6:137618376-137618398 TGGTGACTGTGCCAGGTGACTGG + Intergenic
1018473896 6:164121847-164121869 GGCTCACAGTTCCACGGGGCTGG + Intergenic
1020014715 7:4824281-4824303 GCCTGGCTCTGCCCCGGGACTGG - Intronic
1020015645 7:4829834-4829856 GGCTCACAGTTCCACGTGACTGG - Intronic
1024695662 7:51854295-51854317 GCCTGGCTGTGCCACAGGACGGG + Intergenic
1028109633 7:86924015-86924037 GGGTGACTATCCCAGGGGACAGG + Intronic
1032198667 7:129804405-129804427 GGCTGACTGTCCCACCGCCCAGG + Intergenic
1034479188 7:151306973-151306995 GGGTGACTGTGCCCTGGGTCAGG + Intergenic
1035266257 7:157691783-157691805 GCCTGACTGCGCCAGGGGCCGGG - Intronic
1035709929 8:1705398-1705420 GGCTGACTCAGCCACGGCACGGG - Exonic
1041606964 8:59793070-59793092 GGCTGAATTTGCCACAGGCCTGG + Intergenic
1043398080 8:79857893-79857915 GGGTGACTGGGCCTCGGGACTGG + Intergenic
1045379905 8:101612965-101612987 GACAGACTGTGCCACTGGTCAGG + Intronic
1047438788 8:124858080-124858102 GGGTGAAGGTGCCACGGGGCAGG - Intergenic
1049011286 8:139889365-139889387 GGCTGTCTGTGCCTGGGGACTGG - Intronic
1049011561 8:139890896-139890918 GGCTGTCTGTGCCTGGGGACTGG + Intronic
1051768129 9:20546765-20546787 CCCTGCCTGTTCCACGGGACAGG - Intronic
1058727154 9:107815122-107815144 GGCTGCCTGTGCCACATGCCAGG - Intergenic
1058735619 9:107891369-107891391 GGATGACTGTGCCATTGGTCAGG + Intergenic
1060172289 9:121471770-121471792 TTCTGACTTTGCCACGGGTCTGG - Intergenic
1061021886 9:128020977-128020999 GACTGAGTGTGCCAGGGGTCCGG - Intergenic
1061804753 9:133131661-133131683 GCCTGACTTTCCCAGGGGACAGG - Intronic
1062114788 9:134802573-134802595 GGCTGATTCAGCCACAGGACAGG - Intronic
1062469467 9:136696255-136696277 TGCTGTCTGTGCCACAGCACCGG + Intergenic
1190852248 X:54257162-54257184 GGCTGCCTTTGCCTCTGGACTGG - Intronic
1193080909 X:77405086-77405108 GACTGACTGTGCCCTGGGGCTGG - Intergenic
1200150937 X:153951146-153951168 GGCTGACTGTGGCCCGGTACTGG + Intronic