ID: 997828430

View in Genome Browser
Species Human (GRCh38)
Location 5:137128424-137128446
Sequence CTCAGGGAACAATCAGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997828430 Original CRISPR CTCAGGGAACAATCAGATGG GGG (reversed) Intronic
900363587 1:2301478-2301500 CTCAGGGAACAAGCAGGGTGGGG - Intronic
900912337 1:5608934-5608956 CACATGGAACATTCAGAAGGAGG - Intergenic
902944108 1:19821901-19821923 CTAAGAGAACAATCAGAAGGAGG - Intergenic
903587998 1:24431724-24431746 CTCAGGGAAAAATGGGATCGGGG - Intronic
906338449 1:44955850-44955872 GTCAGGAAACAACCAGATGCTGG + Intronic
907359380 1:53902534-53902556 CTCAGGGGACAATGAGTAGGGGG + Intronic
908059192 1:60328350-60328372 CTCAGGGACAAATCAGAAGTAGG - Intergenic
908637120 1:66179784-66179806 CACAGGGAACCCTCAGAGGGTGG + Intronic
911154245 1:94623425-94623447 CTCAGAGAACACTTAGATGGGGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
916233700 1:162564215-162564237 CTCAGGGAACACACAGATGTAGG + Intronic
917019211 1:170568281-170568303 GTCCAGGAAGAATCAGATGGTGG + Intergenic
918324479 1:183396283-183396305 GTCAGGCAACAATCAGGTGATGG + Intronic
918404387 1:184196971-184196993 CTCAGGCAACAAACAGAGGCTGG + Intergenic
919859102 1:201727027-201727049 CTGAGGAAACAAGCAGAGGGAGG - Intronic
920566604 1:206979113-206979135 GTTAGGGAGCAAGCAGATGGTGG + Intergenic
921901486 1:220456072-220456094 GTCAGGCAACAATCACATGATGG - Intergenic
922069169 1:222174297-222174319 CACAGGGTACAATCCGTTGGTGG + Intergenic
922117255 1:222626058-222626080 CTCACAAAACAATCAGATGGGGG - Intronic
922992329 1:229924894-229924916 CTCAGGGAAGACTCTGAAGGCGG - Intergenic
1065452905 10:25877427-25877449 CCCAGTGAACAATCAAATTGTGG + Intergenic
1065945672 10:30603876-30603898 CTCAGGGAATAGTCAGAAGGTGG + Intergenic
1067716066 10:48691952-48691974 CTCTGGGAACAAACAGCTGCAGG - Intronic
1068823693 10:61409335-61409357 CTCAGGGAACATGGTGATGGAGG - Exonic
1069536422 10:69257031-69257053 TTCAGGGAACACTCATAGGGTGG + Exonic
1070798073 10:79228703-79228725 CTCAGGGAACACTGAAATGGTGG - Intronic
1070849207 10:79549963-79549985 CACAAGGAGCAATGAGATGGAGG + Intergenic
1071009385 10:80920023-80920045 CTCAGGGAAGAATCTGAGTGGGG + Intergenic
1071960303 10:90803650-90803672 GTCAGGCAACCATCAGATGATGG - Intronic
1072917599 10:99548781-99548803 CTGAAGGAACACTGAGATGGTGG - Intergenic
1077993364 11:7432012-7432034 CTAAGGGAACTATGAGAAGGGGG + Intronic
1082789650 11:57338516-57338538 CTCAGGGGACACTCAGAAGGGGG - Exonic
1084747645 11:71183516-71183538 CTCAGGGCACAGCCAGATGAAGG - Intronic
1085424845 11:76395018-76395040 AACATGGAACAATCAGATGTGGG - Intronic
1087113677 11:94499713-94499735 CTTTGGGAACAATCACAGGGGGG - Intergenic
1088835885 11:113577733-113577755 CTCAGGCAATGATCATATGGAGG + Intergenic
1090099300 11:123777123-123777145 CTCAGGGTACAAGGAGATGGTGG - Intergenic
1091159816 11:133409964-133409986 GTCAGGGAACAAGCAGAGGAAGG + Intronic
1091267157 11:134279946-134279968 CTCAGGGAAAAAGAAGAAGGAGG - Intronic
1094324427 12:29221320-29221342 GTCAGGCAACCATCAGATGATGG - Intronic
1095728104 12:45474303-45474325 CTCAGGGTGCAAGCAGCTGGTGG - Intergenic
1097008270 12:55934442-55934464 CTCTGGGAACACTCAGAAGAGGG - Intronic
1097133420 12:56831292-56831314 GTCAGGCAACAATCAGGTGATGG - Intergenic
1098654131 12:73007239-73007261 CTCATGGAACAAACAGCAGGAGG + Intergenic
1099175133 12:79412527-79412549 GTCAGGCAACCATCAGATGATGG - Intronic
1099324712 12:81200065-81200087 CCCAGGGAACACTTAGAGGGAGG - Intronic
1102367167 12:112347750-112347772 CTCAGGGCAGAAGGAGATGGGGG + Intronic
1102803791 12:115761411-115761433 CTCAGTTAAACATCAGATGGTGG - Intergenic
1102871642 12:116418669-116418691 CTCAGGCAACAAGCAGAGGGTGG + Intergenic
1103890149 12:124232381-124232403 ATCAGGGGACAAGCAGATAGAGG + Intronic
1106006884 13:25778974-25778996 CTCTGGAGACAAACAGATGGTGG + Intronic
1110539729 13:76694684-76694706 CTCAGGGAAAAGTCAGAAGGAGG + Intergenic
1110564314 13:76942609-76942631 CACAGGGAATAATCAGAGGCAGG + Intergenic
1114524704 14:23360282-23360304 CTGAGGGATCAAATAGATGGGGG + Intronic
1119386201 14:74259428-74259450 CTCAGGGAGTATTCAGAAGGAGG - Intronic
1120866381 14:89298953-89298975 CTCAGAGAAGATTCAGATGAGGG - Intronic
1123825155 15:24073771-24073793 GTCAGGCAACCATCAGATGATGG - Intergenic
1124078562 15:26469913-26469935 GTCAGGCAACAATCAGGTGATGG + Intergenic
1125311792 15:38387373-38387395 CTCGGGGAAAAATCAGAGGAGGG - Intergenic
1125435053 15:39635559-39635581 GTCTGGGAACAATCGGATGGGGG + Intronic
1130081434 15:80737493-80737515 CTCAGGGATCAGTGAGTTGGGGG - Intronic
1134624741 16:15715388-15715410 CTCAAGAATCAGTCAGATGGTGG + Intronic
1134914681 16:18059882-18059904 CTCAGGAAACACCCAGATAGGGG - Intergenic
1136071151 16:27788077-27788099 CTCAGGGGACAGCCAGCTGGAGG - Exonic
1139486458 16:67259530-67259552 GTCAGCCAGCAATCAGATGGAGG - Intronic
1140555441 16:75916053-75916075 CACAGGGAACACTGAGATGAGGG + Intergenic
1151036522 17:70806274-70806296 TTCAGGCAACCATCAGAAGGGGG + Intergenic
1151829536 17:76541404-76541426 CACAGGGAAGACTCAGGTGGCGG + Intronic
1151954983 17:77375694-77375716 CACAGGGAACCAGCAGATTGAGG - Intronic
1153227862 18:2911576-2911598 GTCAGGCAACCATCAGATGATGG - Intronic
1160905915 19:1451692-1451714 CTCTGGGAACAGCCAAATGGTGG + Exonic
1161717016 19:5882041-5882063 CTCCGGGACCAGCCAGATGGAGG + Intronic
1164489380 19:28692684-28692706 CTCAGGGTGCAAGCTGATGGTGG - Intergenic
1164739817 19:30567588-30567610 CTCAGGGAACAATTGCAAGGTGG - Intronic
1165793308 19:38505133-38505155 CTCAGGGAAGAACCAGGTCGGGG - Intronic
1166255655 19:41602267-41602289 CCCAGGGAACACTCTGTTGGAGG + Intronic
1167954703 19:53055380-53055402 GTCAGGCAACTATCAGATGATGG + Intergenic
1168309811 19:55454778-55454800 CACAGAGAACAATAAAATGGGGG - Intronic
928079071 2:28292675-28292697 CTAAGGCAAGAATGAGATGGGGG + Intronic
928138772 2:28709517-28709539 CACAGGGAACAAAGAGATGGAGG + Intergenic
928496233 2:31835033-31835055 CTCAGGAAACTAACAGATGCTGG - Intergenic
929266933 2:39928885-39928907 CTGAGATAACAATCAGCTGGTGG - Intergenic
930144723 2:47990282-47990304 CTCAGGGAAGAATCTGGGGGCGG - Intergenic
930774789 2:55161136-55161158 CTCTGGGAAAAATTAGGTGGTGG + Intergenic
932671081 2:73738392-73738414 CTCAGAGGCCAAACAGATGGTGG + Intergenic
932999368 2:76902731-76902753 CTCAGTGAAAAATAAAATGGTGG - Intronic
935152189 2:100447894-100447916 CTCAGGGAGCAATCTGAGGCTGG - Intergenic
940566280 2:155364815-155364837 GTCAGGCAACCATCAGATGATGG - Intergenic
941421498 2:165287603-165287625 GTCAGGCAACCATCAGATGACGG - Intronic
943905097 2:193489547-193489569 GTCAGGTGACAATCAGGTGGTGG + Intergenic
945333368 2:208563846-208563868 CTCAGGAAACAGTAAGATGTAGG - Intronic
948476751 2:238225498-238225520 CTCTGGAAACAAACAGATTGGGG + Exonic
1170162934 20:13333908-13333930 CTCAGGGAGCACTCACAGGGAGG + Intergenic
1172319807 20:33987468-33987490 CTCACAGAAAAATCAGATGCTGG + Intergenic
1174540853 20:51288318-51288340 CTCAGGGAAACACTAGATGGAGG - Intergenic
1174729373 20:52900375-52900397 CTCAGGGAACTTACAGATGAGGG + Intergenic
1175805773 20:61828522-61828544 CTAAGAGCACAATCAGCTGGTGG + Intronic
1177939077 21:27386389-27386411 GTCAGGGAACCATTAGATGATGG - Intergenic
1178029751 21:28510567-28510589 CTCAGGGAATTAACAGGTGGAGG + Intergenic
1178697030 21:34802081-34802103 GTCAGGGAAGAATCAGATGTGGG + Intronic
1181718128 22:24750321-24750343 CACAGTGAACACTCAGATTGAGG + Intronic
1183663857 22:39236184-39236206 CTCAGGGAGAAATCAGATTTTGG - Intronic
1184019541 22:41811333-41811355 CTCAGGCAGAAATGAGATGGTGG + Intronic
949422067 3:3876482-3876504 ATCAGAGAAGAATCAGAAGGAGG - Intronic
949530188 3:4947824-4947846 CTCAGGGAGCATTTAGATGAGGG + Intergenic
952978398 3:38715526-38715548 CTCAGGGAACAATTTGATTTGGG - Intronic
956343208 3:68249195-68249217 TCCAGGGAATAATCAGATGGAGG + Intronic
960519547 3:118639290-118639312 GTCTGGGGACAATCAGAGGGAGG - Intergenic
960709305 3:120511398-120511420 CTCAGGCGACCATCAGATGAGGG + Intergenic
962404567 3:135089814-135089836 CTCAGGGAAGGCTCAGAGGGAGG - Intronic
963560596 3:146860125-146860147 CTCAGAGAACCTTGAGATGGTGG + Intergenic
965557164 3:170030551-170030573 GTCAGGGAACAATTTGGTGGAGG + Intergenic
966215158 3:177494379-177494401 CTGAGAGAGGAATCAGATGGAGG - Intergenic
966643535 3:182216915-182216937 CTCAGGGATCCACCAGCTGGGGG + Intergenic
966708452 3:182945382-182945404 CTCAAGGAACAACCAAATGTTGG - Intronic
968482095 4:837774-837796 CTGAGAGGACAGTCAGATGGGGG + Intergenic
968707547 4:2087393-2087415 CTCAGAAAGAAATCAGATGGTGG + Intronic
968926668 4:3551940-3551962 CTCAGGGCCCAATCAGAGGCAGG - Intergenic
969569062 4:7997834-7997856 CACTGAGAAGAATCAGATGGTGG - Intronic
970955942 4:21811281-21811303 TTCATGGAATAATCAGATGTTGG - Intronic
971194307 4:24457232-24457254 CTTGGGGAAAAATCAGATGTGGG + Intergenic
973003836 4:44986224-44986246 GTCAGGCAACCATCAGATGATGG + Intergenic
978781515 4:112559949-112559971 CTCAGTGACTAATCTGATGGCGG + Intronic
979659082 4:123231841-123231863 AGCAGGGAACAACCAGTTGGTGG + Intronic
979722963 4:123924468-123924490 ATCAGGGTACAACCAGATGTAGG - Intergenic
980390947 4:132145791-132145813 GTCAGGCAACTATCAGGTGGTGG - Intergenic
986417123 5:7540323-7540345 CTCAAAGAACAAACAGATGAGGG - Intronic
988073320 5:26323692-26323714 CTTAGGAAATAATCAGAAGGGGG - Intergenic
992957964 5:81929962-81929984 CAGAGGCAACAATGAGATGGAGG + Intergenic
995453803 5:112331464-112331486 CCCAGGGAACACTCAGTTGGGGG - Intronic
997828430 5:137128424-137128446 CTCAGGGAACAATCAGATGGGGG - Intronic
999832755 5:155336490-155336512 CTTAGGGATCAGTCAGATGTTGG + Intergenic
1000981991 5:167825928-167825950 CTCAGGGAACACCCAGAATGTGG - Intronic
1001599051 5:172917093-172917115 CTCAGTGAAGAATCGGATGTGGG + Intronic
1002976473 6:2083125-2083147 CTCAGGGTAAAATCAGACAGTGG + Intronic
1003914592 6:10774901-10774923 TTCAGGAAAGATTCAGATGGAGG + Intronic
1003928752 6:10902672-10902694 TTCAGGGAAAATTCAGATGTTGG + Exonic
1005597370 6:27392184-27392206 TTCAGGGAAACATCAGATAGAGG - Intronic
1005812232 6:29526471-29526493 GTCAGGCAACCATCAGATGGTGG - Intergenic
1007198086 6:40080351-40080373 CTCAGGGATCCCTCAGATGCTGG + Intergenic
1008697748 6:54060895-54060917 CCTAGGGAGAAATCAGATGGAGG + Intronic
1009675172 6:66810652-66810674 TTCAGGGAACAGTAAGCTGGAGG - Intergenic
1011514271 6:88135464-88135486 TTCAGGGAACAAACAGATAAGGG - Intergenic
1011744558 6:90397013-90397035 CTCTGAGAGCACTCAGATGGTGG + Intergenic
1011823692 6:91281639-91281661 CTGAGTGCACAATGAGATGGAGG - Intergenic
1012318043 6:97805091-97805113 CTCAGGCTAAAATCAGATTGAGG + Intergenic
1014837637 6:126177937-126177959 CACAGGGAACAACCAGTTGTGGG - Intergenic
1016390343 6:143568220-143568242 CTCAGGGGACAATCCTTTGGTGG - Intronic
1018287802 6:162259275-162259297 CTCACGGAACAATCGGACGCTGG - Intronic
1019312603 7:369985-370007 CCCAGGTAACAAGCAGAGGGAGG + Intergenic
1019314112 7:376721-376743 CCCAGGGAACAGCCAGACGGTGG + Intergenic
1019348184 7:540705-540727 CACAGGGAACACTCAGATGTTGG - Intergenic
1021240001 7:18188831-18188853 GTCAGGAAACAATAAGATGCTGG + Intronic
1024865685 7:53903368-53903390 CTCAGGAAACTTTCACATGGTGG + Intergenic
1026946201 7:74317754-74317776 CTCTGTGACCAATCTGATGGGGG + Intronic
1028595901 7:92546258-92546280 TTCAGGAAAGAAACAGATGGTGG - Intergenic
1034261671 7:149760652-149760674 CTCAGGTATCTATCAGTTGGAGG + Intergenic
1034281890 7:149860378-149860400 CAAAGGGAACAAGAAGATGGTGG + Exonic
1037944640 8:22981070-22981092 CTCAGAGACAAATCAGTTGGTGG - Intronic
1038230928 8:25699234-25699256 CTCAGGACTCAATCTGATGGAGG - Intergenic
1039729169 8:40255970-40255992 GTCAGGCAACAATCAGGTGATGG - Intergenic
1043138633 8:76559458-76559480 GTCAAAGAACAATAAGATGGGGG - Intergenic
1043925090 8:86027714-86027736 CACAGGGGACTATTAGATGGGGG - Intronic
1044295779 8:90525600-90525622 CTTAGGGGACAATGTGATGGTGG - Intergenic
1045875721 8:106978571-106978593 CTCATGGAAAGATCAGCTGGGGG + Intergenic
1047891673 8:129318673-129318695 CTCAGGGGAGAAGCAGATGGGGG + Intergenic
1050738024 9:8786742-8786764 CTCAGGGAAAAAAAAGGTGGGGG + Intronic
1051062803 9:13064652-13064674 CTCAGGGAACAAGCAGGTTATGG - Intergenic
1052157740 9:25215583-25215605 CCCAGGGGACAATGAGATGGAGG - Intergenic
1052362701 9:27577173-27577195 GTCAGGCAACCATCAGATGATGG - Intergenic
1053801587 9:41767322-41767344 CTCAGGGCCCAATCAGAGGCAGG - Intergenic
1054143614 9:61547504-61547526 CTCAGGGCCCAATCAGAGGCAGG + Intergenic
1054190019 9:61979476-61979498 CTCAGGGCCCAATCAGAGGCAGG - Intergenic
1054463387 9:65478839-65478861 CTCAGGGCCCAATCAGAGGCAGG + Intergenic
1054648495 9:67609115-67609137 CTCAGGGCCCAATCAGAGGCAGG + Intergenic
1055429929 9:76233131-76233153 CCCAGCCAACAGTCAGATGGAGG - Intronic
1056439167 9:86603239-86603261 GTCAGGTGACAATCAGATGATGG - Intergenic
1057283814 9:93731395-93731417 CTGAGGGTTAAATCAGATGGTGG + Intergenic
1057836546 9:98449900-98449922 CTCAGGGAACACTCTGAAGTGGG - Intronic
1058750861 9:108037222-108037244 CTCAGGGAACAGTAACAAGGGGG + Intergenic
1059717909 9:116930849-116930871 CTCAGGAAGCAATCTAATGGAGG - Intronic
1060215930 9:121738154-121738176 CTCAGGGAACCAGCATTTGGTGG + Intronic
1060464110 9:123887402-123887424 CTCAGGGAACAACCTGGTGTGGG + Intronic
1061074828 9:128334691-128334713 CTGAGGGGACATTCAGAAGGCGG + Intergenic
1061330708 9:129890474-129890496 CTGTGGGAACAAGCAGACGGAGG + Exonic
1062421560 9:136484834-136484856 CACTGGGAAGAAGCAGATGGGGG - Exonic
1188245505 X:27831978-27832000 CTTAGGGAACAAGCAGATCAGGG + Intergenic
1192859292 X:75048531-75048553 CTCAGGTAACACTTGGATGGGGG + Intergenic
1194023827 X:88726482-88726504 CTGAGGGAACAAGCTGCTGGTGG + Intergenic
1194978537 X:100416643-100416665 TTCAGTGAAAAATCAGTTGGTGG - Intergenic
1195331844 X:103809189-103809211 GTGAGGAAACAATAAGATGGTGG + Intergenic
1196176844 X:112647662-112647684 GTCAGGGAATAAACAGATGCTGG + Intronic
1197867744 X:131036600-131036622 CTCAGGGGACAGGCAGATAGAGG + Intergenic
1199494014 X:148433020-148433042 CTCAGGGAATAAAGAGATGAGGG - Intergenic
1199943851 X:152650131-152650153 CCCAAGGTACAAACAGATGGAGG - Intronic
1201354684 Y:13084312-13084334 GTCAGGCCAAAATCAGATGGTGG + Intergenic
1201985892 Y:19964828-19964850 CTCGGGGAACAGTGGGATGGGGG - Intergenic