ID: 997831138

View in Genome Browser
Species Human (GRCh38)
Location 5:137151093-137151115
Sequence CTGGTAAAATAGATGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997831138 Original CRISPR CTGGTAAAATAGATGCTGCA GGG (reversed) Intronic
900875113 1:5336967-5336989 TAGATAAAATAGATGCAGCAGGG + Intergenic
900937927 1:5778747-5778769 AGGGTCAAAGAGATGCTGCATGG + Intergenic
903348359 1:22702365-22702387 CTGGTAACAGAGGTGCAGCAGGG - Intergenic
903752811 1:25638587-25638609 CTGATAAAACAAAAGCTGCAAGG - Intronic
905220859 1:36446322-36446344 CCAGTTAAATAAATGCTGCAGGG - Intronic
907336608 1:53703847-53703869 CTGGTAAAATTGGTGCTGAATGG + Intronic
909524723 1:76610118-76610140 CTGGAACAATTTATGCTGCATGG + Intronic
910747152 1:90586539-90586561 ATGGTTAAATAGATGCTGAAGGG - Intergenic
911581172 1:99635066-99635088 CTGATAGAATAGATGTTACATGG - Intergenic
918340187 1:183562298-183562320 CTTTTAAAAAAGATGCTGAAGGG + Intronic
919529237 1:198695600-198695622 ATGGTAAAAAAAATTCTGCAGGG - Intronic
920067710 1:203280895-203280917 CTGGTAGAATATAAGCTTCAAGG + Intergenic
923371315 1:233316905-233316927 CTGCTAAAATATAAGCTCCATGG + Intergenic
1062974605 10:1674269-1674291 CTGGTAAATTTGAGGCTGCGGGG - Intronic
1064447358 10:15407518-15407540 TTGGTAAAATTGAAGCTGGAAGG - Intergenic
1071520379 10:86328517-86328539 CTGGCAAGATAAATGCTGCCAGG - Intronic
1072094507 10:92163820-92163842 CAGGTAAAAAAGATGCTTGAAGG + Intronic
1073664434 10:105514330-105514352 CTGGTAAAACAGATGCAACGTGG + Intergenic
1076672002 10:132127152-132127174 TTGGTAAAATAGATTCTTCAAGG + Intronic
1079434072 11:20427954-20427976 CTAGTGAAATAGATGTTTCAAGG + Intronic
1079955665 11:26861184-26861206 CTGGTAAAATGTATGTTTCAAGG + Intergenic
1080709768 11:34735638-34735660 CAGGTAATATAGATGATGTAAGG - Intergenic
1081557362 11:44177781-44177803 CTGGTAAAGTAAATGCAGAAAGG - Intronic
1086740865 11:90367268-90367290 CTGTCAAAATAGATCCTGCCAGG - Intergenic
1089834710 11:121359841-121359863 CTGGTAAGACAGATCCTGAAAGG + Intergenic
1091353773 11:134919376-134919398 CTGGATAAATAGATGCTGGCAGG - Intergenic
1092159746 12:6309989-6310011 CTGCTAAAATAGATGCTGTGGGG - Intergenic
1093661785 12:21765942-21765964 CTGTTAAAGTAGCTGCTCCACGG - Exonic
1095586137 12:43851910-43851932 TTGGTACAAGAGATGCTGAATGG + Intronic
1097674517 12:62584254-62584276 CTGGTAATGCTGATGCTGCAGGG + Intronic
1098477163 12:70919166-70919188 CTTTTAAAAAAGATACTGCAAGG + Intronic
1100893394 12:99151450-99151472 CTGGAAAGATGGAGGCTGCAGGG + Intronic
1104097105 12:125567851-125567873 CTAGTATAATAGGTGGTGCAAGG + Intronic
1105782216 13:23715353-23715375 GTGGTAGAAAAGTTGCTGCAGGG + Intergenic
1106729664 13:32527134-32527156 CTGGTAAAATAATAGCAGCATGG - Intronic
1109203801 13:59459681-59459703 CTGGTAAAACAGTGTCTGCAAGG + Intergenic
1110243917 13:73300120-73300142 CTGCTAAAATATATGCTTCTAGG + Intergenic
1110886977 13:80651990-80652012 CTGGAAAAAGAGATTTTGCAGGG + Intergenic
1113011340 13:105770568-105770590 CTGGTGAAATAGATGATTCTGGG - Intergenic
1114547032 14:23510588-23510610 AGGGGAAGATAGATGCTGCAGGG + Intergenic
1115102353 14:29717941-29717963 CTGATAAAATGGATTCTCCAGGG - Intronic
1116150700 14:41138264-41138286 CTGGGAAGATAGCTGTTGCATGG + Intergenic
1119631104 14:76232909-76232931 GAGGTAAAATGGATACTGCATGG + Intronic
1120550031 14:85859001-85859023 ATGGCAAAATAGCTGCTCCAAGG - Intergenic
1120598354 14:86469268-86469290 TTGGTAAAATACAAGCTGCTGGG + Intergenic
1126925643 15:53583359-53583381 GTGGTAAAATAGATATTCCAGGG + Intronic
1129367778 15:75067417-75067439 CTGGTAAAAGAGATCCCGGAAGG + Intronic
1132984072 16:2754676-2754698 CAGGTCAAAAACATGCTGCAGGG + Intronic
1137236167 16:46620456-46620478 CTGCAAAAATAAATACTGCATGG - Intronic
1137477864 16:48826212-48826234 CTGATACAATAGATTCTCCATGG + Intergenic
1137533209 16:49297026-49297048 CTGGCACAATACATGTTGCATGG - Intergenic
1138302409 16:55943741-55943763 CTGGTATAATAGCTGGTGCCTGG - Intronic
1138302678 16:55945723-55945745 CTGCTAAAATAGAATCTCCAGGG + Intronic
1139338520 16:66251016-66251038 CTTGTGAAATAGCTGCTGCTGGG - Intergenic
1142770160 17:2090952-2090974 CTGGTAAAATACAGGCTGCTTGG + Intronic
1144224742 17:13134024-13134046 AAGGTTAAATAGATGCTGGATGG - Intergenic
1146716746 17:35092484-35092506 TTGGTAAAATATATGCCTCAGGG - Intronic
1146716750 17:35092522-35092544 CTGGTAAAGTGTATGTTGCAGGG - Intronic
1152376266 17:79920325-79920347 CTGGGACAATAGAGGCAGCAAGG + Intergenic
1156668910 18:39443687-39443709 CTATAAAAATAGATGTTGCAGGG + Intergenic
1158140951 18:54255100-54255122 ATGGTGAAATAGATTGTGCAGGG - Intergenic
1158924807 18:62244977-62244999 CTGCTAAAATAGATACTGGAAGG - Intronic
1159865369 18:73697611-73697633 CTGGTAAAATAGTGGTTGCTAGG - Intergenic
1161828412 19:6585313-6585335 CTTGTCAAATAGATGCACCAAGG + Intronic
1162730389 19:12715155-12715177 CAGGGCAAATAGGTGCTGCAGGG + Exonic
1164906714 19:31974014-31974036 CCAGCAAAATAAATGCTGCATGG + Intergenic
1165998847 19:39865409-39865431 GGGGTAGAATAGATGCTGGAAGG + Intronic
1168522505 19:57063544-57063566 CTGGTTAAGAAGATTCTGCAAGG - Intergenic
925385739 2:3460409-3460431 CTGGTATAATAGATGCTGGCAGG + Intronic
926328174 2:11803259-11803281 CTAGTAAACTAGATCCTCCAGGG - Intronic
926535814 2:14110881-14110903 TTGGTAAAATAGATGCTTTCAGG + Intergenic
927366283 2:22300592-22300614 CTGGTGGAATAGATGCTGTTTGG - Intergenic
929893562 2:45938561-45938583 CTGAATAAATAGCTGCTGCAAGG - Intronic
932179698 2:69634775-69634797 ATGGTGAACTAGATGCAGCAAGG - Intronic
933770748 2:85742410-85742432 ATGGAAAAATAGAAGCTTCAGGG - Intergenic
934607038 2:95703684-95703706 ATGGTTAAATAGTTGTTGCAGGG + Intergenic
937085084 2:119166284-119166306 CTGGATAAATAGTTCCTGCATGG - Intergenic
937463265 2:122107967-122107989 ATGGTAAATCAGATGCTGCATGG - Intergenic
943749419 2:191496017-191496039 CTGGAATTATAGCTGCTGCAAGG - Intergenic
946762062 2:223004522-223004544 CTAGTAGACTAGAAGCTGCAGGG - Intergenic
946856732 2:223957485-223957507 CTGGTAAGATTGCTGCAGCAGGG + Exonic
948130807 2:235599381-235599403 CTGGGGAAGTGGATGCTGCAGGG + Intronic
948391729 2:237616288-237616310 CAGGTGAAATGGAGGCTGCAGGG + Intergenic
1169411010 20:5370337-5370359 CTGGAAGAAGAAATGCTGCAAGG + Intergenic
1174116034 20:48226873-48226895 CTGGAAAAGTAAATGCCGCAGGG - Intergenic
1175478141 20:59291562-59291584 CTGGTAACATATATGCAGTACGG + Intergenic
1177664147 21:24130825-24130847 CTAGTAAACTAGACACTGCAGGG + Intergenic
1177721257 21:24909668-24909690 CTGGTAAATTAAATGCTGATGGG - Intergenic
1177734059 21:25066379-25066401 TCAGTAAAATAGATGCTGGAAGG + Intergenic
1178157839 21:29875238-29875260 CTGGTAGAAATGATGCTCCAGGG - Intronic
1178281069 21:31283486-31283508 ATGGGAAAAGAGATGCTGCTTGG - Intronic
1179634418 21:42698230-42698252 CTGGTAAGAGAGGTGCTACAAGG - Intronic
1180539536 22:16430637-16430659 CTGGAAAAATAGAAGCTACTAGG - Intergenic
1181665489 22:24393054-24393076 ATGGTAGAAGAGATGCTGCATGG - Intronic
1183908358 22:41060064-41060086 CTGGATAAAAAGATTCTGCAGGG - Intergenic
949492926 3:4606591-4606613 ATGGTAAAACACATGTTGCAAGG + Intronic
953420364 3:42749324-42749346 CAGATCAAAGAGATGCTGCAGGG - Intronic
955707670 3:61745471-61745493 CTTCTAAAGTACATGCTGCATGG - Intronic
956002815 3:64747321-64747343 GTGGTTAACTAGATGCTGAAAGG - Intergenic
956604074 3:71053882-71053904 CTGGATAAATACATGTTGCATGG - Intronic
956846079 3:73184026-73184048 CAGGTAAACTACATGTTGCATGG + Intergenic
958585687 3:96084169-96084191 CTGTGAAAATAGTTACTGCAAGG + Intergenic
958643259 3:96836426-96836448 CTTGTAAAATAGAACCTTCAAGG - Intronic
958847570 3:99283254-99283276 CTGGAAAAATAAATGCTTGAGGG + Intergenic
959412848 3:106046825-106046847 CTGATAAAATAGTTTCTCCAGGG - Intergenic
959647494 3:108720374-108720396 CTGATAAAACAGATGATTCAAGG - Intergenic
959726745 3:109551865-109551887 CTGGTAACAGGGATTCTGCAAGG + Intergenic
962454149 3:135549716-135549738 AACGTAAAATAGATGCTGCCAGG - Intergenic
967757742 3:193189156-193189178 CTGGTAACATAGATTTAGCAAGG + Intergenic
970463498 4:16299409-16299431 ATGTTAAAATATATTCTGCAGGG + Intergenic
970705233 4:18793567-18793589 ATGGTAAAATACAGGCTGAAGGG + Intergenic
972822589 4:42718807-42718829 CTGGGAAAACAGATGTTTCAGGG + Intergenic
972884757 4:43471762-43471784 GAGGTACAATAGATGCTTCATGG + Intergenic
972977551 4:44655803-44655825 CTTATAAAATAGAAGCAGCACGG - Intronic
973196599 4:47450246-47450268 CTTGTAAAGGAGATACTGCATGG + Intergenic
973583737 4:52370848-52370870 CTAGTAAAATAGGAGCTCCAGGG - Intergenic
974085342 4:57254610-57254632 CTGGCAAAATGAATGCTGGATGG - Intergenic
974293443 4:59963900-59963922 CTGGTAAAATTGGTGGTTCAGGG + Intergenic
976831583 4:89320938-89320960 CTGCACAAATAGATGCTTCAGGG + Intergenic
977078929 4:92497712-92497734 CTGGAAAAAAAGATTGTGCAGGG - Intronic
977249630 4:94675502-94675524 CTGGTACAACAGATCCTGCATGG + Intergenic
977349241 4:95859608-95859630 CTAGTAAAAATGATGTTGCATGG + Intergenic
979354307 4:119685081-119685103 ATGGTAAAATAGCTGCTCAAAGG - Intergenic
981300123 4:143177874-143177896 CTGGTAAAAGAGACCCTGGAAGG - Intergenic
983971630 4:173882698-173882720 CTGGTAAAGTGGATGCTGGATGG - Intergenic
984471063 4:180174716-180174738 AAGGTACAATAGATTCTGCAAGG + Intergenic
985369774 4:189273993-189274015 CAGGTAATATAGATTTTGCATGG - Intergenic
986511126 5:8507264-8507286 TTGATAAAATAGAAGCTCCAAGG - Intergenic
988042660 5:25909576-25909598 CTGGTCAAATAGCTGCTTCCCGG - Intergenic
990688539 5:58335747-58335769 CTGGTCAAATAAATTGTGCATGG + Intergenic
992783234 5:80146753-80146775 CTGTTAAAATAAATGTGGCAGGG - Intronic
993572391 5:89557606-89557628 CTGGTAAAAAAGATGATGGTGGG + Intergenic
994380117 5:99060874-99060896 CTGGGAAAATAAATGCTGAATGG - Intergenic
994626200 5:102222504-102222526 TTGGTAAAATAGCAGCAGCAGGG + Intergenic
996455977 5:123681395-123681417 CTGGGAAGATAGCTGTTGCATGG + Intergenic
996750711 5:126885894-126885916 ATGGAAAAATAGATGTTCCATGG - Intronic
997831138 5:137151093-137151115 CTGGTAAAATAGATGCTGCAGGG - Intronic
1003350326 6:5311286-5311308 TAGATTAAATAGATGCTGCAGGG + Intronic
1004174408 6:13327138-13327160 CTGATAAAATAGATGGCACAAGG + Intronic
1007152244 6:39705280-39705302 CAGGTAACATTGATGCTGCTGGG + Intronic
1007452101 6:41947917-41947939 GTGGGAGTATAGATGCTGCAGGG - Intronic
1008489695 6:52073412-52073434 CTAGTTACATACATGCTGCATGG - Intronic
1010771409 6:79835841-79835863 CTGGTTAAATTGGTCCTGCATGG + Intergenic
1011444010 6:87418241-87418263 CTGGTAATCAATATGCTGCATGG - Exonic
1011634933 6:89362810-89362832 CTGGTTAAATAGCTACTGAAAGG + Intergenic
1014074312 6:117219143-117219165 CTGCAAAAATAGAAGCTCCAAGG - Intergenic
1014537368 6:122630732-122630754 CTGATAAAATCGGTACTGCACGG + Intronic
1016932159 6:149422184-149422206 CTGGGGAAATCGAAGCTGCAGGG - Intergenic
1018151018 6:160939874-160939896 CGGGTCACATGGATGCTGCAAGG + Intergenic
1018192447 6:161322060-161322082 CTGGTAAAATGGATGCACCCAGG + Intergenic
1019973911 7:4564374-4564396 CTGCTAAAATAGAAACTTCAAGG + Intergenic
1020874743 7:13678444-13678466 CTGGTAAAATAGGTTCTTCTGGG - Intergenic
1021258161 7:18420541-18420563 CTCATAAAATTCATGCTGCAGGG + Intronic
1021702635 7:23334954-23334976 CTTGTAAAATAGATACTCCTGGG + Intronic
1022594264 7:31697115-31697137 CAGGTAAAAAAGCTGGTGCAGGG + Exonic
1022753311 7:33255642-33255664 TAGTTAAAATAAATGCTGCAAGG - Intronic
1023604418 7:41915922-41915944 CTGGCAAAATACAAGCTTCAGGG + Intergenic
1024044567 7:45578022-45578044 CTGGAACAATGAATGCTGCAGGG - Intronic
1024475639 7:49806054-49806076 TTGATAAAATGGATGTTGCATGG + Intronic
1031540360 7:122987972-122987994 CTGGTAACATAAATGCAGAAAGG - Intergenic
1034848807 7:154474361-154474383 CTTGTAACAGAGATGCGGCAAGG + Intronic
1036717465 8:11139564-11139586 CTCGGAAAACAGATGCTCCAGGG + Intronic
1036805476 8:11829470-11829492 CTGGTAAGAAAGCTGCTGAAAGG - Intronic
1038097728 8:24334276-24334298 CTTGTAAAGTAGATGTTGGATGG + Intronic
1038712475 8:29960637-29960659 CTGACAAAAATGATGCTGCATGG - Intergenic
1040330832 8:46384967-46384989 CAAGCAAAAAAGATGCTGCAAGG + Intergenic
1041528179 8:58832638-58832660 CTGCTAAATTAGAAGCAGCAGGG - Intronic
1042153335 8:65813831-65813853 ATGATATAATAGATGCTGTAAGG - Intronic
1042333430 8:67606528-67606550 ATGGTAAAAGGGAGGCTGCAGGG - Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043586427 8:81775234-81775256 CTTTTCAAATAGGTGCTGCAGGG - Intergenic
1045666886 8:104497463-104497485 CTGATAAAGTGAATGCTGCAAGG - Exonic
1046008559 8:108516735-108516757 TTGGAAATATAAATGCTGCATGG + Intergenic
1046264865 8:111817514-111817536 CTTATAAAAGAGATGCTGGAGGG - Intergenic
1047241882 8:123098279-123098301 CTGGAAGAATAGAAGGTGCAAGG - Intronic
1047741493 8:127810357-127810379 ATGGTAAACTAGATCCTGAAAGG + Intergenic
1048030859 8:130630569-130630591 CTGGAAAACTAGATTCTCCAAGG + Intergenic
1048157190 8:131968344-131968366 CTCGTAAAAAAGATGCTCCCCGG + Exonic
1051986934 9:23100826-23100848 CTGGTAAAAGAGATACTCCCTGG + Intergenic
1052204528 9:25823147-25823169 CTGGTTAAAAAGCTTCTGCACGG - Intergenic
1053777776 9:41565924-41565946 CTGGTTAAATTGATACTACATGG + Intergenic
1054967096 9:71041711-71041733 CTGGGAAAATAAAGGCTGCCTGG - Intronic
1058357668 9:104103240-104103262 CAGGTAAAAAAGATGTTTCAAGG + Intronic
1058643464 9:107109025-107109047 CTGGAAGAAGAGATGCTGGAAGG - Intergenic
1062024534 9:134334186-134334208 CTGGGAAAAAAGAGGCTGGATGG - Intronic
1186341290 X:8648999-8649021 CTGATAAAGGAGATGCTGCCTGG - Intronic
1187094781 X:16136295-16136317 CTCTTAGAATAGATGCTGCTAGG - Intronic
1191867506 X:65716879-65716901 CTGGTCAAATAGCTGCTTCCCGG - Exonic
1193321631 X:80129651-80129673 ATGGGAAAAGTGATGCTGCATGG - Intergenic
1196180266 X:112681860-112681882 CTGGAATAAGAGATTCTGCAAGG + Intergenic
1197992216 X:132330386-132330408 GTGCTAAAACAGGTGCTGCAAGG - Intergenic
1199499698 X:148496406-148496428 CTGGTTAGATAGATCCTGGAAGG + Intergenic
1199532614 X:148867376-148867398 CTGGTAAAAGAGATGAGGGAAGG + Intronic
1201538108 Y:15073969-15073991 CTGGTAAAATGAATGCTGACAGG - Intergenic