ID: 997831141

View in Genome Browser
Species Human (GRCh38)
Location 5:137151104-137151126
Sequence CTATTTTACCAGATGGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997831137_997831141 18 Left 997831137 5:137151063-137151085 CCAAGGAGAATGCAAATCTATAT 0: 1
1: 0
2: 0
3: 30
4: 315
Right 997831141 5:137151104-137151126 CTATTTTACCAGATGGTAGTAGG 0: 1
1: 0
2: 1
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997831141 Original CRISPR CTATTTTACCAGATGGTAGT AGG Intronic
911551761 1:99291167-99291189 CTTTTTTATCATATGCTAGTTGG - Intronic
911871228 1:103101944-103101966 TTATTTTACCAGATAACAGTAGG + Intronic
915641257 1:157228740-157228762 CTAGTTTTCCAGATGAGAGTAGG + Intergenic
915668231 1:157464194-157464216 CTAGTTTTCCAGATGAGAGTAGG - Intergenic
916506903 1:165436324-165436346 CTATTTTACCAAAGGGTGGGAGG - Intronic
916968739 1:169984535-169984557 CTTTTTTAGCATATGGTATTTGG - Intronic
918083336 1:181224110-181224132 CTCTTTGACCAGATGGTGTTGGG + Intergenic
918352360 1:183670296-183670318 CTATTTTACCAGAGCCTACTGGG - Intronic
919771344 1:201161161-201161183 CTATTCAACCAGATGGTAAGGGG - Intronic
921162904 1:212485701-212485723 CTATTTCATCAGATGGTTATGGG - Intergenic
922703007 1:227772792-227772814 CTGGTTTACCAGATGGTGTTGGG - Intronic
924028870 1:239866882-239866904 CTATTTTATCAGATGGTTGTTGG - Intronic
924884146 1:248194328-248194350 CTTTTTTATCATATGTTAGTTGG - Intergenic
1063111129 10:3038344-3038366 CTATTTAAACAGAAGGTATTTGG - Intergenic
1068453968 10:57231480-57231502 CCATTTTTCCAGCTGGGAGTGGG + Intergenic
1072523128 10:96247411-96247433 CTTTTTTATTAAATGGTAGTAGG + Intronic
1080695002 11:34595838-34595860 CTATTTCAGTAGGTGGTAGTGGG + Intergenic
1094698412 12:32844315-32844337 ATATTTTCCCAGTTTGTAGTTGG - Intronic
1098531595 12:71547726-71547748 CCAGTTTACCACATGGTAATAGG + Intronic
1101379033 12:104197705-104197727 CTATTTTATCAGATATAAGTAGG + Intergenic
1101770785 12:107748909-107748931 CTAATTTAGCAGAAGGTAGGAGG - Intronic
1102284252 12:111642447-111642469 CTGTTTTCCCAGGTGGTGGTGGG + Exonic
1104119839 12:125788812-125788834 ATATTTTAAAAGATGGCAGTGGG + Intergenic
1106130171 13:26933251-26933273 CTGTTTTACTAGATGGTGATGGG - Intergenic
1109836476 13:67863827-67863849 ATATTTAACCAGAAGGCAGTGGG + Intergenic
1110188442 13:72702034-72702056 CTATTTTACATGATGGTTCTCGG + Intergenic
1111494320 13:89028335-89028357 CTATTATACCAAATACTAGTAGG + Intergenic
1112567363 13:100562926-100562948 CTTTTTTAGCACATGGCAGTGGG - Intronic
1117717777 14:58598430-58598452 TCATTTTAGCAGATGTTAGTGGG + Intergenic
1118401180 14:65380864-65380886 CTAATTTTCCAGATGGTAAATGG - Intergenic
1120343808 14:83257647-83257669 CAATTTAACCAGATAGAAGTGGG + Intergenic
1125635503 15:41184967-41184989 CTGTTGTACCAAATGGTAATTGG + Intronic
1129549701 15:76434767-76434789 CTATTTTGCCATTTTGTAGTAGG - Intronic
1130059997 15:80562893-80562915 CCATTTCACCAGAAGGTAGACGG + Intronic
1135928202 16:26713689-26713711 TTATTTTACCAGAAGGAAGATGG + Intergenic
1138894402 16:61185463-61185485 CTAATTTACCAGCTGGAACTGGG + Intergenic
1146861191 17:36300628-36300650 CTGTTTTACTAGATGGATGTTGG - Intronic
1147091522 17:38104732-38104754 CTGTTTTACTAGATGGATGTTGG - Intergenic
1147105690 17:38215773-38215795 CTGTTTTACTAGATGGATGTTGG + Intergenic
1150168990 17:62971902-62971924 CAATTTTTCCAGAGGGTAGGGGG - Intergenic
1153099755 18:1452705-1452727 TTATTTTAGTAGATGGTCGTTGG - Intergenic
1153778915 18:8477296-8477318 CTATTTGTGCAGTTGGTAGTGGG + Intergenic
1154491487 18:14925549-14925571 TTATTTTGCCAGATGGTAGCAGG + Intergenic
1157056890 18:44240160-44240182 CTATTTTATCAGGTTGTTGTAGG - Intergenic
1157705784 18:49804791-49804813 TTTTTTTGGCAGATGGTAGTAGG - Intronic
1159887090 18:73919123-73919145 CTATTTCACCTGATTGTTGTAGG - Intergenic
1164869938 19:31634435-31634457 CCATTTTGCCAGATGGGAGAAGG + Intergenic
1165821445 19:38678891-38678913 CTTGTTTATCTGATGGTAGTGGG + Intronic
926047910 2:9723655-9723677 CTATTTTTTCAGATAGAAGTGGG - Intergenic
931348026 2:61464460-61464482 CTTTTTCACCAAATGGTATTGGG + Intronic
932644939 2:73490316-73490338 CTATTTTAGCAGAAGGTAGAAGG + Exonic
935378511 2:102424687-102424709 CTACATTAGCAGATGTTAGTAGG - Intronic
936500283 2:113061278-113061300 CTTTTTTCCCATATGGGAGTGGG + Intronic
936725855 2:115314427-115314449 CTATTGTAACAGAGGGTAATTGG - Intronic
941680978 2:168399169-168399191 CTATGTTTCCAGAAAGTAGTTGG + Intergenic
942594485 2:177580110-177580132 CCCTTTTGGCAGATGGTAGTAGG + Intergenic
946476667 2:220012770-220012792 CTATTGTACTCTATGGTAGTAGG - Intergenic
948733446 2:239982020-239982042 CTATTAGAGCAGAAGGTAGTTGG - Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1181135615 22:20763952-20763974 CTATTTTACTAGAGGGTTGGTGG + Intronic
949558387 3:5179379-5179401 CTCTATCACCAGATGGCAGTTGG + Exonic
951388577 3:22073675-22073697 CTATCTTACAAGATTGTAGGGGG + Intronic
955530812 3:59871414-59871436 CTATGTTACAGGATTGTAGTAGG - Intronic
957050539 3:75408493-75408515 CTCTTTTACCTGATTGTATTAGG + Intergenic
959382443 3:105657689-105657711 CTATTTTACAAAATGGTGGTTGG - Exonic
960326899 3:116308125-116308147 CAATTTTAAAAGATGGTAGGGGG - Intronic
960510065 3:118539471-118539493 CTATTTTAACAAATGGTGATAGG - Intergenic
961882838 3:130074933-130074955 CTCTTTTACCTGATTGTATTAGG + Intergenic
962356917 3:134702589-134702611 CAAATTTACAAGATGGTTGTAGG - Intronic
962493904 3:135920571-135920593 CTATTTTTCCAGATGGAAGAGGG - Intergenic
965853624 3:173062009-173062031 CTATTTTAACAAATAGGAGTAGG - Intronic
965944707 3:174225937-174225959 CTATTTTACTAGATGTTATATGG - Intronic
966058874 3:175731720-175731742 CTTTGTTGCCAGAAGGTAGTTGG + Intronic
966576873 3:181511978-181512000 CTATTTTACCACAGTGTATTTGG - Intergenic
967288798 3:187899224-187899246 CAAATTTACCAGATGATTGTTGG + Intergenic
967505507 3:190248653-190248675 GCATTTTTTCAGATGGTAGTTGG + Intergenic
976083266 4:81380000-81380022 CTATTTTAACAAATGGAGGTGGG + Intergenic
979745929 4:124213006-124213028 CTGTTTTACCAGATGGCTGCTGG - Intergenic
984684404 4:182649896-182649918 GTATTCTACCAGAGGGTAGTGGG - Intronic
986744084 5:10729299-10729321 CTATTTTCAAAGATGGTGGTGGG - Intronic
997831141 5:137151104-137151126 CTATTTTACCAGATGGTAGTAGG + Intronic
997864870 5:137452462-137452484 TTCTTTTACCAGGTGGCAGTAGG - Intronic
1006673926 6:35748641-35748663 CCATTTCACCACGTGGTAGTGGG - Exonic
1010068017 6:71708824-71708846 CAATTTTACCAAATGATAGAGGG - Intergenic
1010985421 6:82418228-82418250 CAATTTTACCAGGTTGTAGGAGG - Intergenic
1012589741 6:100966813-100966835 CTAGTTTACTAGATGATTGTGGG - Intergenic
1014258580 6:119189277-119189299 CTATTTTATAAGAAGGGAGTGGG + Intronic
1014391291 6:120868854-120868876 CTATTTTTCCATGTGGTGGTTGG + Intergenic
1015678479 6:135778093-135778115 CTACTTTAGCAAATAGTAGTTGG + Intergenic
1015722582 6:136259146-136259168 GTATTATACCAGAGTGTAGTAGG - Exonic
1016611013 6:145989611-145989633 CTATTTTACCAAAGGGTTATTGG - Intergenic
1020682965 7:11259359-11259381 CTAATTTACAAGATGGTGGCAGG - Intergenic
1022810814 7:33866710-33866732 CCATTTGACCAGGTGGTAGTCGG - Intergenic
1028649666 7:93137616-93137638 CAATTTTTCCACAGGGTAGTGGG - Intronic
1030840424 7:114345801-114345823 GTATTATACCATATGGAAGTGGG + Intronic
1041173239 8:55166824-55166846 CTAGTCCACCAGATGGTACTGGG - Intronic
1041361029 8:57054655-57054677 ATATTTTAACAAATGTTAGTCGG + Intergenic
1043466047 8:80507975-80507997 TAATTTTAAAAGATGGTAGTAGG + Intronic
1044163373 8:88948873-88948895 CTATGTTCCCACATGGTAGAAGG + Intergenic
1058159302 9:101550080-101550102 CTATTTTACAAGTTGTTTGTAGG + Intronic
1058572935 9:106366921-106366943 CTATTTCACCACAAGGGAGTTGG + Intergenic
1060333344 9:122696806-122696828 TTATTTTTACAGATGGTATTAGG + Intergenic
1185704605 X:2257441-2257463 CTAGATGACCAGATGGTGGTAGG - Intronic
1197552728 X:127914227-127914249 CTTTTTTACCATATTATAGTTGG + Intergenic
1199376470 X:147116511-147116533 CTAGTTTTCCTGATTGTAGTAGG + Intergenic
1199723769 X:150562716-150562738 CTATTTTGCCAGGTGCTAGATGG - Intergenic