ID: 997831322

View in Genome Browser
Species Human (GRCh38)
Location 5:137153049-137153071
Sequence CTCTCACCCAACACAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997831317_997831322 24 Left 997831317 5:137153002-137153024 CCAAGAGACTAAAGACAGTGTCT 0: 1
1: 0
2: 4
3: 8
4: 248
Right 997831322 5:137153049-137153071 CTCTCACCCAACACAGTGTCTGG 0: 1
1: 0
2: 0
3: 21
4: 260
997831318_997831322 -1 Left 997831318 5:137153027-137153049 CCTCTTCACTGCCACATGCCACC 0: 1
1: 0
2: 5
3: 31
4: 306
Right 997831322 5:137153049-137153071 CTCTCACCCAACACAGTGTCTGG 0: 1
1: 0
2: 0
3: 21
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997831322 Original CRISPR CTCTCACCCAACACAGTGTC TGG Intronic
900867085 1:5276256-5276278 CTCTCACCCACCATAGTGGGTGG - Intergenic
902117805 1:14136357-14136379 CCCTCACCTCACAGAGTGTCAGG + Intergenic
902554649 1:17239844-17239866 CTCTGACCCAACCCAGTTCCTGG - Intronic
902794780 1:18793985-18794007 AGATCACCCAACACAGAGTCAGG + Intergenic
903037676 1:20504377-20504399 CTGACACCCAGCACAGTGCCTGG - Intronic
903701053 1:25248217-25248239 CTCACACCAAACACAGTTTTTGG - Intronic
904600335 1:31669394-31669416 CTCTCACCCTACAAAGTGACAGG - Intronic
907073254 1:51556459-51556481 CTCTCACCCTTCCCAGTCTCTGG - Intergenic
907141973 1:52195454-52195476 CTGGCACCCAGAACAGTGTCTGG - Intronic
907940507 1:59082899-59082921 CCCACACCCAGCACAGGGTCTGG + Intergenic
911288396 1:96026454-96026476 CACTCTCACAACACAGTGTTAGG + Intergenic
911758182 1:101584941-101584963 TTATCACCGAACACAGTCTCAGG + Intergenic
914665499 1:149829222-149829244 CTCTCACCCAGCCTAGGGTCAGG - Intergenic
914670266 1:149864572-149864594 CTCTCACCCAGCCTAGGGTCAGG + Intronic
914685983 1:149980083-149980105 CTCTCACCCAGAAGACTGTCTGG - Intronic
915030718 1:152878545-152878567 CTCTCATCCAACACACTGAATGG - Intronic
915493389 1:156264425-156264447 CTAGTACCTAACACAGTGTCTGG - Intronic
917983436 1:180290115-180290137 TTATCACACAACACAGTGTGTGG + Intronic
919730866 1:200912900-200912922 CTGCCACCCTACCCAGTGTCAGG - Intronic
920684078 1:208095881-208095903 CTCTGTCCAAACAAAGTGTCAGG + Intronic
921051213 1:211513129-211513151 GTATCACACAACAGAGTGTCTGG - Intergenic
921189027 1:212693608-212693630 CTGTCATGCAACACAGTCTCTGG + Intronic
922704129 1:227780097-227780119 GTCTCACCCAGCATAGTGGCTGG + Intronic
923482241 1:234396506-234396528 CACGTACCTAACACAGTGTCTGG - Intronic
924553073 1:245096471-245096493 CTGGTACCCAGCACAGTGTCTGG - Intronic
1062768236 10:81184-81206 CACTCCCCCAGCACAGGGTCTGG + Intergenic
1062939672 10:1411669-1411691 CTCACACCCGACACACTGTGGGG - Intronic
1064845411 10:19646711-19646733 CTGACACTCAAAACAGTGTCTGG + Intronic
1065584243 10:27201979-27202001 CTCATCCCCAAAACAGTGTCTGG - Intronic
1066363848 10:34757284-34757306 TTCTCATCTAACACAGTATCTGG + Intronic
1067803573 10:49377233-49377255 CTCTGCCCCAGCACAGAGTCTGG - Intronic
1069260813 10:66393710-66393732 ATGTTACCCAACACAGTGCCTGG - Intronic
1070421744 10:76244241-76244263 AGCTCACCCAACTCAGTGCCTGG + Intronic
1070560104 10:77559771-77559793 CTCTGGCCCAACACAGAGTAGGG + Intronic
1070870584 10:79748194-79748216 CCCTTGCCTAACACAGTGTCTGG + Intergenic
1070906659 10:80079050-80079072 CTCCCAGCCAACTCTGTGTCTGG + Intronic
1071522331 10:86339110-86339132 CCAGCACCCAACACAGTGCCTGG + Intronic
1071587688 10:86841160-86841182 TTCTGACCTAACACAGTGCCTGG - Intronic
1071637502 10:87270406-87270428 CCCTTGCCTAACACAGTGTCTGG + Intergenic
1071657743 10:87467545-87467567 CCCTTGCCTAACACAGTGTCTGG - Intergenic
1071855314 10:89618458-89618480 GTCTCACCCAGCACAGTATCTGG - Intronic
1072267007 10:93740516-93740538 CTCCCACCCAAATCACTGTCTGG + Intergenic
1075288394 10:121207165-121207187 ATCACACCTAACACAGTGCCAGG - Intergenic
1075780192 10:125012399-125012421 CTCTCAGCCACCACTGTGGCTGG + Intronic
1077644522 11:3911641-3911663 CTCACACCCAACACTGTGGGAGG - Intronic
1079237115 11:18698896-18698918 CGCTCACTCACCACAGTGACCGG - Exonic
1079691724 11:23426914-23426936 CTCTCAACCAACCCAGTCCCTGG + Intergenic
1080081935 11:28231103-28231125 ATCTGCCCCAAAACAGTGTCTGG - Intronic
1080462011 11:32463012-32463034 CTATCACCTAGCACAGGGTCTGG + Intergenic
1081481017 11:43489340-43489362 TTCTCACCCATCAGATTGTCAGG + Intronic
1081815207 11:45935307-45935329 CACTCCCCCCACACACTGTCAGG + Intronic
1083983708 11:66195335-66195357 TGCTTTCCCAACACAGTGTCTGG - Intronic
1084461069 11:69296926-69296948 AACACACCCAGCACAGTGTCTGG - Exonic
1084645342 11:70453855-70453877 CTCTTACTCAACACAGTGCTAGG - Intergenic
1085884214 11:80503455-80503477 TTCTCACCCAGCAAACTGTCAGG - Intergenic
1086096403 11:83054196-83054218 CTCTCATCCTAGACAGGGTCAGG + Intronic
1086670885 11:89546240-89546262 CTATCACCAAACACAGTGCCTGG - Intergenic
1086847777 11:91773496-91773518 GTCTAACCCAACACAGTCCCAGG - Intergenic
1088095695 11:106098706-106098728 CACAAATCCAACACAGTGTCAGG - Exonic
1088738757 11:112749619-112749641 CTGGAACCCATCACAGTGTCTGG + Intergenic
1089139659 11:116275638-116275660 CTCTCAACCAAGACAGAGTGGGG + Intergenic
1089168993 11:116499647-116499669 CTCTCTCCCAACCCAGGGGCGGG + Intergenic
1091319993 11:134642551-134642573 CTCTCATCCCACACAGTGCTTGG - Intergenic
1092064236 12:5576615-5576637 CACACACCCAACACAGCATCTGG + Intronic
1095277594 12:40306706-40306728 TTGGCACCCAACACAGTGCCTGG + Intronic
1095685886 12:45032986-45033008 CCCTCACCCAAAGCAGTGTATGG - Intronic
1096236649 12:49932875-49932897 CCATCACCCAGCCCAGTGTCTGG + Intergenic
1096417763 12:51428340-51428362 TTCTCACCTAGCACAGTGCCTGG + Intronic
1097289048 12:57898518-57898540 CTCACACACTGCACAGTGTCTGG + Intergenic
1097440813 12:59605589-59605611 CTAACATCCAAAACAGTGTCTGG - Intronic
1098287199 12:68919441-68919463 CTCTAGCCTAACACAGTGCCTGG + Intronic
1098307965 12:69120309-69120331 CTAGCACCTAAGACAGTGTCTGG + Intergenic
1101204918 12:102476998-102477020 CCCTCACCTAACACCCTGTCAGG - Intronic
1106401976 13:29440173-29440195 ATCTCACCCAGCACAGTGGTGGG + Intronic
1106882974 13:34151945-34151967 ATCAAACCCAACACAGTGCCTGG - Intergenic
1107098319 13:36560480-36560502 CTGTCACCTAGCTCAGTGTCTGG - Intergenic
1107372197 13:39765378-39765400 CACTCACCCAATCCAGGGTCTGG - Intronic
1112961175 13:105128319-105128341 CAAGCACCCAACACACTGTCTGG - Intergenic
1116350385 14:43854890-43854912 CTAACACCTAAAACAGTGTCTGG - Intergenic
1116495921 14:45560001-45560023 AACTGACCCAGCACAGTGTCAGG - Intergenic
1117829940 14:59740187-59740209 CTTGCACCCAGCACAGTGCCTGG + Intronic
1121006216 14:90492133-90492155 CACCCACCCACCACTGTGTCTGG - Intergenic
1122166576 14:99829328-99829350 CCCTCACCCCACAAAGTCTCTGG + Intronic
1122609837 14:102974457-102974479 GTGTCACCCAGCACAGTGCCTGG + Intronic
1123206864 14:106721621-106721643 CTCTCACTTAGCACAATGTCTGG + Intergenic
1123211885 14:106768626-106768648 CTCTCACTTAGCACAATGTCTGG + Intergenic
1123438080 15:20270219-20270241 CTGGCACCCAGCACAGTGCCAGG + Intergenic
1124027804 15:25982931-25982953 CTCTCACCCAGTCCCGTGTCTGG + Intergenic
1124157193 15:27236372-27236394 CTCTCAGCCAACAGTGGGTCAGG - Intronic
1124693877 15:31847300-31847322 CTCACAACCAACTCAGTATCAGG - Intronic
1125023721 15:35009852-35009874 CTGTCACCCAACTCAGAGTCTGG + Intergenic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1131885107 15:96903915-96903937 TTCTCACCCTTCAAAGTGTCTGG + Intergenic
1132953634 16:2579097-2579119 CTCTGACCTAAAGCAGTGTCTGG - Intronic
1132960717 16:2621070-2621092 CTCTGACCTAAAGCAGTGTCTGG + Intergenic
1133449367 16:5890831-5890853 CATTCACCCAACATTGTGTCTGG + Intergenic
1133808688 16:9144808-9144830 CTAACACCCAGCACAGTGCCTGG - Intergenic
1135883352 16:26280672-26280694 CTGTCACCTAGCACAGTGCCTGG - Intergenic
1136846498 16:33580633-33580655 CTGGCACCCAGCACAGTGCCAGG - Intergenic
1137049336 16:35694558-35694580 CTCTCTCCCATTAAAGTGTCTGG + Intergenic
1137701714 16:50502486-50502508 CTCTCACCCATCACCCTCTCTGG + Intergenic
1138200477 16:55084591-55084613 CTTTCACCCAACTCTGTTTCAGG + Intergenic
1139075220 16:63438170-63438192 GTCTCACACAATACAGTGTGTGG - Intergenic
1139947518 16:70651388-70651410 TTCTCACCCAATACTGTATCAGG + Intronic
1140033485 16:71356466-71356488 CTCTCACCCAACACAGATTTGGG + Intergenic
1141269598 16:82526938-82526960 CCAGCACCCAACACAGTTTCTGG + Intergenic
1141274032 16:82568776-82568798 CTGTACCCCAGCACAGTGTCTGG + Intergenic
1141770168 16:86085153-86085175 ATCTCACCCAGCACAGGGCCAGG - Intergenic
1203108206 16_KI270728v1_random:1429287-1429309 CTGGCACCCAGCACAGTGCCAGG - Intergenic
1143172541 17:4938505-4938527 CACTCACCCGCCACAGTGTGAGG + Exonic
1143609590 17:8010174-8010196 CAAGCACCCAACACAGTGTCTGG + Intronic
1145825540 17:27874643-27874665 CCAGCACCCAGCACAGTGTCTGG - Intronic
1146464915 17:33078832-33078854 CTAACACCTAACACAGTGCCTGG + Intronic
1146806059 17:35865869-35865891 CTAGCACCCAGCACAGTATCTGG - Intronic
1147459457 17:40559048-40559070 CTTTCAGCAAACACAGTGCCTGG - Intronic
1148756542 17:49976054-49976076 CACTGACCCAACACAGGGTGAGG - Intergenic
1149123617 17:53200708-53200730 CCCTCACCCTCCACAGTCTCTGG + Intergenic
1151073362 17:71243489-71243511 CTCTCAACCACCCCAGTCTCTGG + Intergenic
1151328212 17:73391682-73391704 CTGGCTCCTAACACAGTGTCAGG - Intronic
1153660300 18:7320046-7320068 CCCTCACCCACCACAGCGCCTGG - Intergenic
1155287093 18:24300827-24300849 CTCTCTCTCAATACAGGGTCTGG + Intronic
1158932396 18:62334460-62334482 CTCCCACCCTACACAGAGCCTGG - Intronic
1159890899 18:73952272-73952294 CTCTCATCCATCACTGTGTTGGG + Intergenic
1161705381 19:5818445-5818467 ATCTCACACAGCACACTGTCAGG - Intergenic
1162142062 19:8591109-8591131 CTCTCACCAAACCCAGTGACAGG - Intronic
1163323682 19:16589228-16589250 CTGTCACCCAAGAAAGAGTCTGG + Intronic
1163761918 19:19141948-19141970 CGCTCACCCAACCCAGACTCAGG - Intergenic
1164011833 19:21210433-21210455 CTTTCATCCATCACTGTGTCAGG + Intergenic
1164048861 19:21566911-21566933 ATTTTACACAACACAGTGTCAGG + Intergenic
1165034049 19:33020120-33020142 CTGGCACCCAGCACAGTGCCAGG + Intronic
1165774924 19:38398903-38398925 CTCTCACCCATCCCAGGGTCTGG - Intergenic
1165935083 19:39384231-39384253 CTCTCAGCCAAGACAGTGGCAGG + Exonic
1168361526 19:55744901-55744923 CTCTCACCCAATTTAGAGTCCGG + Intergenic
925457690 2:4030109-4030131 GACTCACCCAGTACAGTGTCTGG + Intergenic
926440968 2:12888379-12888401 CTCTCACCAATCACAGATTCAGG - Intergenic
927299531 2:21495842-21495864 ATCTCAGCCAACAGAGTGGCTGG - Intergenic
936154826 2:110040787-110040809 CTCCCACCCATCGCAGTGTGAGG - Intergenic
936189856 2:110330627-110330649 CTCCCACCCATCGCAGTGTGAGG + Intergenic
936377507 2:111954491-111954513 CCATCACCCAGCACAGTGCCTGG + Intronic
937703871 2:124895509-124895531 ACCTCAGCCAACCCAGTGTCAGG - Intronic
939418336 2:141930593-141930615 TGCTCACCCACCACAGTGACTGG - Intronic
941506946 2:166357931-166357953 CTCTCCCCAAACAATGTGTCAGG + Intronic
943721552 2:191207972-191207994 TTAGCACCCAACACAGTGCCTGG + Intergenic
943730164 2:191294066-191294088 CTATCACCTAGAACAGTGTCTGG - Intronic
944422099 2:199542294-199542316 CTGGCATCCAACACAGGGTCTGG + Intergenic
945457540 2:210066691-210066713 CTTTCACTCAACATATTGTCTGG + Intronic
1170697023 20:18668465-18668487 CTCTCACCCCTAACAGTGGCAGG - Intronic
1171933304 20:31248182-31248204 CTGTCACCCTTCAAAGTGTCTGG - Intergenic
1172021856 20:31920266-31920288 CACACACCCAGCACAGTGCCTGG + Intronic
1172062084 20:32193527-32193549 CTCCCACCCTACACAGTAGCTGG - Exonic
1172812390 20:37658023-37658045 CTCTCACTCAACACAAAATCTGG + Intergenic
1174203063 20:48820479-48820501 TTTTCACCCAGCAGAGTGTCTGG - Intronic
1174223704 20:48978999-48979021 CTCCCATTCAACACAGTGTTGGG - Intronic
1179584020 21:42363757-42363779 CTCTCACCTGGCACAGTGCCTGG - Intronic
1180065166 21:45408728-45408750 CCCTCCCCCAACACAGTGAGCGG - Intronic
1180729581 22:17971592-17971614 CTTAGCCCCAACACAGTGTCTGG - Intronic
1181474113 22:23158127-23158149 CTCACACCCACCACGGGGTCAGG - Intronic
1182248806 22:28983195-28983217 CAGTCACCCATCCCAGTGTCAGG + Intronic
1183077215 22:35434818-35434840 CTCCCACCCAAAGCATTGTCGGG - Intergenic
1183382567 22:37497525-37497547 CTGGCACCAAACCCAGTGTCTGG + Intronic
1185085276 22:48737549-48737571 GGCTCACCCAGCACAGTGTGCGG - Intronic
949977864 3:9477204-9477226 CTCTCATCCAGAACAGTGTTAGG - Exonic
950428946 3:12939945-12939967 TGGGCACCCAACACAGTGTCTGG + Intronic
950523886 3:13512447-13512469 CTGGCACCCAACACAGGGCCTGG - Intergenic
950863407 3:16170227-16170249 CTCACACTCAGCACAGTGCCTGG - Intergenic
951149072 3:19265924-19265946 GTCTGACCTAAGACAGTGTCAGG - Intronic
952540920 3:34366818-34366840 CTATCACCAAACACAAAGTCAGG - Intergenic
952546213 3:34422363-34422385 CTTACACCCATCACAGTGCCAGG + Intergenic
952589785 3:34937230-34937252 CTATGACCCAACAAAGTTTCTGG + Intergenic
952599127 3:35057561-35057583 AGCTCACCCAAGACAGTGTCTGG - Intergenic
953068968 3:39501242-39501264 CTCTCAACAAACTCAGGGTCAGG - Intronic
953850147 3:46459808-46459830 CTCTCTCCCAGGACTGTGTCTGG - Exonic
954091562 3:48288478-48288500 CTGTCACCCAGCACAGTACCAGG - Intronic
955456495 3:59127342-59127364 CTCTAATCCAGCTCAGTGTCTGG - Intergenic
956041595 3:65150783-65150805 CAAGCACCCAGCACAGTGTCTGG + Intergenic
956404023 3:68909405-68909427 CTAGCACCTAACACAGTGCCTGG + Intronic
957506255 3:81125270-81125292 ATCACCACCAACACAGTGTCAGG - Intergenic
960966757 3:123110893-123110915 CTCGCACACAACACAGTAACAGG - Intronic
962967780 3:140370423-140370445 TTTTCACGCAACACAGCGTCTGG + Intronic
966433080 3:179853223-179853245 CTAGCACCCAGCACAGTGCCTGG + Intronic
967700946 3:192591677-192591699 CTGTCACTCACCTCAGTGTCTGG - Intronic
967935791 3:194726376-194726398 CCCTCCCCCAGGACAGTGTCTGG + Intergenic
968950373 4:3688434-3688456 CTCACACCCAAGACAGAGTCGGG - Intergenic
969136606 4:5034294-5034316 TTCTCACCAAACACACTGTAGGG + Intergenic
969283300 4:6186053-6186075 CAGCCACTCAACACAGTGTCTGG + Intronic
970582976 4:17490296-17490318 CAAGCACTCAACACAGTGTCTGG - Intronic
972370129 4:38415669-38415691 CTCTCTCCCATCTCAGTCTCAGG - Intergenic
973079199 4:45968649-45968671 CTCTCACCAGAAACAGAGTCTGG + Intergenic
975343294 4:73265316-73265338 TTCTCACCTAACCCAGTGCCTGG - Intergenic
975402367 4:73952747-73952769 CTATCACCCCAAACAGTGACAGG + Intergenic
976367549 4:84247135-84247157 CTCCCACCCTACACAGTAGCTGG + Intergenic
978193115 4:105939081-105939103 CTAGCACTCAGCACAGTGTCTGG - Intronic
979074072 4:116249139-116249161 CTGTCACCTAACATAGTGACTGG - Intergenic
981046735 4:140271763-140271785 CTATCACCTAGCACAGTGCCTGG - Intronic
982194414 4:152895883-152895905 CTATCACCTAACTCAGTGACTGG - Intronic
983445904 4:167851819-167851841 GTCTCATACAACACAGTGTCTGG + Intergenic
983924606 4:173386537-173386559 ACCACACCCAAAACAGTGTCTGG - Exonic
984868623 4:184307778-184307800 CTCAGACACAACACAGGGTCAGG + Intergenic
985192766 4:187394677-187394699 CTAACACTTAACACAGTGTCTGG - Intergenic
986326090 5:6675735-6675757 CTCTCATTCAGCACAGAGTCTGG + Intergenic
987323336 5:16790293-16790315 CTGGTACCCAGCACAGTGTCTGG - Intronic
989209704 5:38846542-38846564 CTCTCTCCCAACACATCGTGTGG + Intronic
990099541 5:52164584-52164606 CTCTCCCCCTACCCAGTGTGTGG + Intergenic
990182592 5:53178641-53178663 CCATCACCTAACACAGTGCCTGG + Intergenic
992909980 5:81386970-81386992 AACTCATCCAACTCAGTGTCTGG - Intronic
993176026 5:84486750-84486772 CTGTTACCAAGCACAGTGTCTGG + Intergenic
993333548 5:86629364-86629386 CTGTTACCTAACACAGTTTCTGG + Intergenic
995066965 5:107873353-107873375 CTATCACCTATCACAGTGACTGG + Intronic
995575737 5:113531230-113531252 CTCTCATCCATCACTGGGTCAGG - Intronic
995623179 5:114050295-114050317 GTCACACACAGCACAGTGTCTGG - Intergenic
995871300 5:116746264-116746286 CTCTCACCCTACAGAGTACCAGG + Intergenic
997831322 5:137153049-137153071 CTCTCACCCAACACAGTGTCTGG + Intronic
997844588 5:137275394-137275416 CTCTCACCAAACACAGGGATTGG + Intronic
998059804 5:139111025-139111047 ACCTCACCCACCACAGTGTCAGG + Intronic
998167653 5:139853454-139853476 CTCTGCTCCAAAACAGTGTCTGG - Intronic
998906761 5:146913357-146913379 CTCTCTCCCATTACAGTGTCTGG + Intronic
999934143 5:156466955-156466977 CGATCACTCAACACAGTGACTGG + Intronic
1003337819 6:5191456-5191478 CTCTCTCACAACACATTTTCAGG - Intronic
1004865418 6:19848703-19848725 GTCTCCCCTAACACAGTGTCAGG + Intergenic
1006155659 6:32011578-32011600 CTCGCAGCCCATACAGTGTCAGG + Intergenic
1006161990 6:32044432-32044454 CTCGCAGCCCATACAGTGTCAGG + Exonic
1007827115 6:44608790-44608812 CCCACACCCAACACAGTGCCAGG - Intergenic
1007947182 6:45837161-45837183 CACTCATTCAACACACTGTCTGG - Intergenic
1009475477 6:64085447-64085469 CTATCTCCAAACACATTGTCAGG + Intronic
1017270445 6:152497193-152497215 CCATCATCTAACACAGTGTCTGG + Intronic
1017653059 6:156600748-156600770 CGCTTACCCAACACAGTATTTGG - Intergenic
1018868952 6:167767027-167767049 CCCTCACCCAGGACAGTGTGTGG - Intergenic
1020871843 7:13640595-13640617 CTAGCACACAACACAGTGTGTGG - Intergenic
1022098528 7:27155712-27155734 CTCTCACCCGACCCTGTGCCAGG - Intronic
1022540236 7:31128405-31128427 CTCCAACCCAACTCAGTGCCGGG - Intergenic
1022806301 7:33825845-33825867 CTACCACCCAGCACAGTGCCTGG - Intergenic
1024363329 7:48492481-48492503 CAATGACCTAACACAGTGTCTGG - Intronic
1026584302 7:71643768-71643790 TTCTCTCCTAACACCGTGTCTGG - Intronic
1029940652 7:104477370-104477392 CTATCACCAAGCACAGTGCCTGG - Intronic
1032268670 7:130385130-130385152 CTCTGTCCCCCCACAGTGTCCGG + Exonic
1032467388 7:132154682-132154704 CTTTGACCCACCACACTGTCTGG - Intronic
1032610359 7:133405956-133405978 CCAGCACCTAACACAGTGTCTGG - Intronic
1034869608 7:154672378-154672400 AACACACCCAGCACAGTGTCTGG + Intronic
1034913374 7:155016751-155016773 ATCTCACCCAACATAATGTCTGG + Intergenic
1034943193 7:155245168-155245190 CTCTCACCCATCCCAGGGGCCGG + Intergenic
1035705344 8:1670486-1670508 CTCTCACAGGACACAGTGTGTGG - Intronic
1035735886 8:1887409-1887431 CTCACACCCCACTCAGGGTCTGG - Intronic
1037265647 8:17056652-17056674 CTGTGAGCCAACACAGTATCTGG - Intronic
1038002979 8:23405989-23406011 GTCACACCCTACACAGTGCCTGG + Intronic
1038900745 8:31841000-31841022 CTCTAACCTAGCACAATGTCTGG - Intronic
1040006804 8:42627969-42627991 ATCTCACCTAACAGAGTGGCTGG + Intergenic
1042226873 8:66521122-66521144 CACCCCCCCAATACAGTGTCAGG - Intergenic
1044491643 8:92825198-92825220 CTGTCACCTACCACAGTGTCTGG + Intergenic
1045594222 8:103634375-103634397 ATCACACCAAACACACTGTCAGG - Intronic
1047003082 8:120592594-120592616 CTAGCTCCCAGCACAGTGTCTGG - Intronic
1047361522 8:124173555-124173577 CTGGCACCCAGCACAGTGTCTGG - Intergenic
1048571900 8:135663514-135663536 CTCTCCCCCAACCCAGCGCCTGG + Intergenic
1048952445 8:139507659-139507681 CTCTCAGCAAACACAGGGTGGGG - Intergenic
1049072733 8:140369398-140369420 CACTCACCCAACACACTGCATGG + Intronic
1049832772 8:144712934-144712956 TTCTCACTCAACACTGTCTCTGG + Intergenic
1051676073 9:19559748-19559770 CTCCCACCCAAAACAGTGGCTGG + Intronic
1051707269 9:19893786-19893808 CTCTCACGCCACACAGGGTTAGG + Intergenic
1053116687 9:35510594-35510616 CTTTCACACACTACAGTGTCTGG + Intronic
1055099114 9:72445054-72445076 TCATCACCCAGCACAGTGTCTGG + Intergenic
1056248240 9:84720221-84720243 CTTTCAACCAATACAGTGTTTGG - Intronic
1056623548 9:88235388-88235410 CCTTCTCCCAAGACAGTGTCTGG + Intergenic
1059730832 9:117055247-117055269 CCAGCACCCAACACAATGTCTGG - Intronic
1060547979 9:124471759-124471781 CTGGCACCCAGCACAGTGCCTGG - Intronic
1061226471 9:129283672-129283694 CTCACTCCCATCACAGGGTCTGG - Intergenic
1061638388 9:131929952-131929974 GTCTGACCCAGCACAGTCTCAGG + Intronic
1185834659 X:3333991-3334013 CTCTCTCTCAAGACAGGGTCTGG + Intronic
1186066642 X:5773514-5773536 CACACCCCCAAGACAGTGTCTGG + Intergenic
1187302025 X:18059853-18059875 CTCGCACTCACCACAGTGCCAGG - Intergenic
1187551027 X:20306213-20306235 CCCTCACTCAACATAGTATCTGG - Intergenic
1188299578 X:28491247-28491269 AGCACACCCAACACAGTGCCTGG + Intergenic
1190522538 X:51294991-51295013 CTCTGAGTCAACACAGTGCCTGG - Intergenic
1190525775 X:51328180-51328202 CTCTGAGTCAACACAGTGCCTGG - Intergenic
1190543712 X:51503488-51503510 CTCTGAGTCAACACAGTGCCTGG + Intergenic
1191231580 X:58100245-58100267 CTCTCTCCCATGACAATGTCAGG - Intergenic
1192668431 X:73112638-73112660 CTCTCCCCCTACCCAGTGTGTGG + Intergenic
1193668896 X:84358973-84358995 GTCTCACTCAACACAGAGTTGGG - Intronic
1196774499 X:119326203-119326225 CTCACATCCAGTACAGTGTCTGG - Intergenic
1197167775 X:123396962-123396984 CTCATGCCTAACACAGTGTCTGG - Intronic
1197626959 X:128813015-128813037 CCAGCACCCAGCACAGTGTCTGG + Intergenic
1197802779 X:130369388-130369410 CCACCACCTAACACAGTGTCTGG - Intronic
1198728534 X:139702420-139702442 CCATCACCTAACACAGTGCCTGG + Intronic
1199388722 X:147254581-147254603 CTCTCACTCATCACAGTGTTAGG + Intergenic