ID: 997834693

View in Genome Browser
Species Human (GRCh38)
Location 5:137182751-137182773
Sequence AAGTGAAGACCTTTAGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997834693_997834696 8 Left 997834693 5:137182751-137182773 CCCTGAGCTAAAGGTCTTCACTT 0: 1
1: 0
2: 0
3: 13
4: 132
Right 997834696 5:137182782-137182804 GAAGTGGCCACAGTACCATCAGG No data
997834693_997834695 -8 Left 997834693 5:137182751-137182773 CCCTGAGCTAAAGGTCTTCACTT 0: 1
1: 0
2: 0
3: 13
4: 132
Right 997834695 5:137182766-137182788 CTTCACTTGCTCAATAGAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997834693 Original CRISPR AAGTGAAGACCTTTAGCTCA GGG (reversed) Intronic
900079975 1:849057-849079 AAGTGAACAACTTTAGTCCATGG - Intergenic
905754343 1:40495986-40496008 AAGTGAAGAGTTATAGCTGAAGG - Exonic
909338041 1:74499147-74499169 AAGTAAAGACCCTGAGTTCAAGG - Intronic
912055073 1:105585879-105585901 AAGAGAAGACTCTTATCTCAAGG - Intergenic
912718870 1:112003105-112003127 AAGTGAAGAACTTGAGATCATGG - Intergenic
913667160 1:121058888-121058910 AAGGGAAGACCTTGAATTCAAGG + Intergenic
914018851 1:143846040-143846062 AAGGGAAGACCTTGAATTCAAGG + Intergenic
914657402 1:149754243-149754265 AAGGGAAGACCTTGAATTCAAGG + Intergenic
915104954 1:153528034-153528056 AAGAGAGCCCCTTTAGCTCACGG - Intergenic
919309087 1:195883879-195883901 AAATGAAGACCCTGGGCTCAAGG + Intergenic
919769502 1:201148250-201148272 AAGTAAAGACCTGTGGCTGAGGG - Intronic
923107871 1:230868419-230868441 AAGTGAAGCGCTTTCGCTCCCGG + Exonic
1062977611 10:1697079-1697101 AAATGAAAACCTTTAGATCAGGG - Intronic
1064543284 10:16426608-16426630 ATGTGAAGTCTTTTTGCTCAAGG - Intergenic
1067662559 10:48247371-48247393 AAGTGCAGACCCTTCACTCAGGG + Intronic
1068337156 10:55648926-55648948 AAGTGAAGACCTTCTTCACATGG + Intergenic
1068970942 10:62957426-62957448 CAGTGAATACCTTTATATCATGG + Intergenic
1069853600 10:71426188-71426210 AAGTCAAAACCATTTGCTCAGGG - Intronic
1071506137 10:86232992-86233014 AAGTGAAGAATTTTAGATGAGGG - Intronic
1072155514 10:92719925-92719947 AAGTGAAGAGCTTTTTCTGAAGG + Intergenic
1072511094 10:96125519-96125541 AAGTGAAGACCTATAACTTGTGG + Intergenic
1072775191 10:98184206-98184228 AAGGGAAGACCTAAAGCTGAGGG - Intronic
1073909001 10:108318760-108318782 AAGAGAAGCCATTTAGCTCTGGG - Intergenic
1081088676 11:38833848-38833870 AAGTATAGACCTGAAGCTCAGGG + Intergenic
1088021491 11:105125165-105125187 AAGTGAAAACCTGCATCTCAGGG + Intergenic
1088415812 11:109587720-109587742 ATGTAAAAACCTTTAGCACAGGG + Intergenic
1090856964 11:130618275-130618297 AAGTGAAGACAATTATCACATGG + Intergenic
1090983786 11:131748088-131748110 AATTGAACACATTTAGCTTATGG - Intronic
1091199070 11:133757812-133757834 CAGTGAAGACCTTAGGCTCGAGG + Intergenic
1091772669 12:3163184-3163206 AAATGAATAGCTTGAGCTCAAGG - Intronic
1093960685 12:25269758-25269780 AAGAAAAGAGGTTTAGCTCATGG + Intergenic
1099914047 12:88869923-88869945 AAGAGAAGACTTTTAGCTAAAGG + Intergenic
1100472458 12:94905687-94905709 TAGTGAAGACCTTTGGTTCTGGG - Intronic
1101097716 12:101360311-101360333 AGGTGAACACCTTGAGCCCAGGG + Intronic
1101140082 12:101786342-101786364 AAATGAAGACTTTTATCTCATGG + Intronic
1103799865 12:123531250-123531272 AAGTGAACACCGTGCGCTCAGGG - Intronic
1105405716 13:20131102-20131124 AAGTGAAAATTTGTAGCTCAGGG + Intergenic
1105678580 13:22702748-22702770 AATAGAACACCTTGAGCTCAGGG + Intergenic
1106987806 13:35376117-35376139 CAGTAAAAACCTTTAGATCATGG - Intronic
1107758505 13:43651388-43651410 AAGTGAAGTCTTTTATCACAAGG - Intronic
1108852244 13:54745569-54745591 AAGTGAAGTACTATAGTTCATGG - Intergenic
1110000013 13:70185187-70185209 AAGTGAAGACCTGAAGATAAAGG - Intergenic
1114796004 14:25715508-25715530 AAGAGAAGACCTGAAGCTGAGGG + Intergenic
1120022254 14:79543954-79543976 ACGTTAACACCATTAGCTCAAGG - Intronic
1120456776 14:84740763-84740785 AATTGAAGACCTTCACTTCAGGG - Intergenic
1121822542 14:96983068-96983090 AAGTGGAGGTCTTTAGCCCAGGG + Intergenic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1128351889 15:66896396-66896418 TAGTGAAGACCCTGAGCTGAGGG + Intergenic
1133666905 16:7977506-7977528 AACTGAAGTCCTCTAACTCAAGG - Intergenic
1135295954 16:21279299-21279321 AAGGGAAGAAATTTAGTTCAAGG + Intronic
1135386037 16:22040997-22041019 AAGTAAAGACATTTAGTTCCAGG + Intronic
1137536247 16:49328973-49328995 AAGTGAAGCCCTTGACCTCAGGG + Intergenic
1140809406 16:78562746-78562768 GAGTTAAGATCTTTAACTCAGGG + Intronic
1143371295 17:6441772-6441794 AAGAAAAGACACTTAGCTCATGG + Intergenic
1148468871 17:47881139-47881161 AAGTGAAGTCCATTATCTCCAGG - Intergenic
1149006251 17:51809395-51809417 AAGTATAGCCCTTTATCTCAAGG + Intronic
1152865558 17:82720673-82720695 AAGGCAAGACCTTTAACCCAGGG + Intronic
1153628891 18:7049746-7049768 AACTGAAGACATTGAGATCATGG - Intronic
1156916909 18:42472584-42472606 AGGGCAATACCTTTAGCTCAGGG - Intergenic
1158669985 18:59465942-59465964 GAGTGATGCCCATTAGCTCAAGG - Intronic
1159186657 18:64983979-64984001 AAGTCCCGACCTTCAGCTCAGGG + Intergenic
1161174742 19:2834650-2834672 AAGGGAAGACCTCTGGCTGAAGG - Exonic
1161258710 19:3323691-3323713 AAGGGATGACCTTGAGCTCCGGG + Intergenic
1167725909 19:51212381-51212403 AAGAGGAGACCTTCAGCTCAGGG + Intergenic
1168598861 19:57701917-57701939 GAGTGCAGACCTTTGGCTAAAGG + Exonic
1168598893 19:57702169-57702191 GAGTGCAGACCTTTGGCTAAAGG + Exonic
930844922 2:55893042-55893064 AAGTGAAAACCTTTGGCTTCAGG + Intronic
930911982 2:56640183-56640205 AAGTGGGTACCTTTAGCTGAGGG + Intergenic
932787403 2:74619136-74619158 GAGGGAAGACATTTAGCTGAAGG - Intronic
934054795 2:88242728-88242750 AAGTGAAGTCCTATAGCCAACGG + Intergenic
935658284 2:105443511-105443533 AAGAGAAGAACCTCAGCTCAAGG + Intergenic
938543135 2:132303205-132303227 AAGTGAAGACCCCTACCTCTAGG - Intergenic
939124411 2:138158904-138158926 AAGTGAATACTTTTACCTAAGGG - Intergenic
942696231 2:178649544-178649566 AAGTGAATACCTTTAGCTGCTGG + Exonic
942911343 2:181247682-181247704 AAGGGAAGGCTCTTAGCTCAGGG + Intergenic
944622859 2:201535833-201535855 AAAAGAAGGCCTTGAGCTCAAGG - Intronic
944761099 2:202814487-202814509 AAGTAAAAAAGTTTAGCTCATGG - Intronic
945692052 2:213048602-213048624 AAGTGAATTCCTTTAACTCAGGG + Intronic
947166401 2:227266631-227266653 AAATGAATACTTTTAGCTAATGG - Intronic
947354190 2:229275152-229275174 AAGTGAATTACTTTAGCCCAGGG - Intergenic
1170336871 20:15279931-15279953 AGGTGAAGTCCTTGACCTCAAGG - Intronic
1171187411 20:23132850-23132872 AAAGGAAAACCTTTAGCTTAAGG - Intergenic
1171872019 20:30536039-30536061 AAGTGAAGACCCCTACCTCTAGG - Intergenic
1174631113 20:51957812-51957834 AAGTGAAGAAATTTTGCCCAGGG - Intergenic
1180692095 22:17725642-17725664 AAGGCAAGACCTTGTGCTCAAGG - Intronic
1182929809 22:34162212-34162234 CAGTGAAGACCTCTAGATCATGG - Intergenic
1183325399 22:37188593-37188615 CAGTTAAGCACTTTAGCTCAGGG - Intronic
1184135072 22:42543599-42543621 AGGTGAAGACCTTAAGAACAGGG - Intergenic
951405863 3:22296640-22296662 AAGTGAAAACCACTAGCTGAAGG - Intronic
957838467 3:85632655-85632677 AAATCAAGACATTTACCTCATGG - Intronic
960040890 3:113148881-113148903 ATGGGAAAACATTTAGCTCAAGG + Intergenic
960209241 3:114939550-114939572 AATTTATGACCTTTAGCTGAGGG + Intronic
960290800 3:115882031-115882053 AAGTGAAGCCCCTTGTCTCAAGG + Intronic
967363927 3:188664163-188664185 AAGAGGACACTTTTAGCTCAAGG - Intronic
967365971 3:188686875-188686897 GAGTGAAGACCTTGATATCAAGG + Intronic
976956471 4:90907117-90907139 AATTGCAGACCTTTACCACAGGG + Intronic
979949175 4:126870914-126870936 CAGTGAGGAACTTTAGCTCCTGG + Intergenic
980173478 4:129316988-129317010 AAATTAAGCACTTTAGCTCATGG - Intergenic
980281670 4:130731324-130731346 AACTGAAGACATTTAACTCAAGG - Intergenic
985836583 5:2276454-2276476 AAATGAAGAACTTTGGCTCCGGG + Intergenic
987306152 5:16639712-16639734 ATAGGAAGACCTTAAGCTCAAGG + Intergenic
993154365 5:84203698-84203720 CAGTTAAGAACTTTAGGTCAAGG + Intronic
995056716 5:107767435-107767457 AAGTGAATAATTTTAGGTCAGGG + Intergenic
997001772 5:129770292-129770314 AAGTGGAGACTTATAGCTAAGGG - Intergenic
997507826 5:134432416-134432438 AAGGGAAGACCTTTAGATACAGG - Intergenic
997750796 5:136343623-136343645 AAGTGAAGACCTTAAGACCCAGG - Intronic
997834693 5:137182751-137182773 AAGTGAAGACCTTTAGCTCAGGG - Intronic
1000783670 5:165515568-165515590 AATAAAAGTCCTTTAGCTCATGG - Intergenic
1003624883 6:7731712-7731734 CAGTGAAGACATTTAGGACAGGG + Intronic
1003681860 6:8264920-8264942 AAGAGAAGGCCCTTTGCTCAAGG + Intergenic
1004840400 6:19577402-19577424 CAGTGAAGAGCAGTAGCTCAGGG + Intergenic
1007227885 6:40327700-40327722 AAGTGAAGACACTGAGCTCTGGG + Intergenic
1008071131 6:47100265-47100287 AAATGAAGACATTCAGCCCAAGG - Intergenic
1011592657 6:88985550-88985572 AAGTAAAGTCCTTGAGGTCAGGG - Intergenic
1014001934 6:116373687-116373709 AAGTTAAGAGCTTCATCTCATGG - Intronic
1014308184 6:119767701-119767723 AAGGGAAGACATTTAGTCCATGG + Intergenic
1015822257 6:137276885-137276907 AAGTGCAGGCCCTTAGCTAAGGG - Intergenic
1018050323 6:160003913-160003935 AAGTAAAGACCTTGAGTTGAGGG + Intronic
1019136092 6:169908578-169908600 AAATGAAGACACTTAGCACATGG + Intergenic
1020436843 7:8173820-8173842 AATTGAACACCTATAGCTCTCGG + Intronic
1022472952 7:30692951-30692973 AAGTGAAGACCTGTGGGTCACGG + Intronic
1027762092 7:82291803-82291825 AACTGAAAACATTTAGCTCTGGG - Intronic
1030106481 7:105991787-105991809 AAATGAAGCCCTTTCCCTCATGG + Intronic
1031790669 7:126099153-126099175 AAGTGAAGACCTAAAACTGAGGG - Intergenic
1035250828 7:157595900-157595922 AAATGAAGACCAGTAGCCCAAGG + Intronic
1035525529 8:309855-309877 AAGTGAACAACTTTAGTCCATGG + Intergenic
1037907958 8:22726597-22726619 AAGTGAAGGCCTACAGCCCAGGG - Intronic
1040566607 8:48573213-48573235 AGGTGAAGACGTTGAGCTGAGGG - Intergenic
1047445783 8:124918110-124918132 AAGTGAAGTCCCTTATTTCAGGG + Intergenic
1047554380 8:125913149-125913171 AAGTGAAGATCTTTGTCTCAGGG + Intergenic
1047597414 8:126392984-126393006 AAGTGAGGACCTTAACCTTATGG + Intergenic
1048358119 8:133670308-133670330 AAATGAAGTCTGTTAGCTCAGGG - Intergenic
1050070876 9:1812478-1812500 AAGTTAAAAACTCTAGCTCACGG - Intergenic
1050133511 9:2438674-2438696 AAGGGAAGACCTGGGGCTCAAGG + Intergenic
1051492667 9:17683760-17683782 AAGGGAAGACCTAAAGCTGAGGG + Intronic
1057862643 9:98653809-98653831 CAGTGCTGACCTTTAGCTCATGG + Intronic
1188945728 X:36299010-36299032 AAGTGAAGACCTCTATCTTTTGG - Exonic
1194180599 X:90706668-90706690 AAGCGAAGACCTTTTTCACATGG + Intergenic
1195268182 X:103204197-103204219 CAGTGAAGACATTTGGTTCAGGG + Intergenic
1195775878 X:108405512-108405534 TTGTGAAGTCCTTTAGGTCAGGG + Intronic
1197362143 X:125517937-125517959 AACTGAAGATATTTAGCCCAGGG + Intergenic
1197737911 X:129866009-129866031 AAGTGAAGACCATTTTATCAAGG + Intergenic
1199261190 X:145777461-145777483 AACTCAAGCCCTTTAGCTCCAGG - Intergenic
1199355163 X:146854138-146854160 AAGAGAAGACCTCCAGCTGAAGG - Intergenic
1200514436 Y:4126233-4126255 AAGGGAAGATCTGTGGCTCAAGG - Intergenic
1200527260 Y:4288828-4288850 AAGCGAAGACCTTTTTCACATGG + Intergenic