ID: 997837605

View in Genome Browser
Species Human (GRCh38)
Location 5:137208383-137208405
Sequence TCTCCCATCTATGAGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997837605 Original CRISPR TCTCCCATCTATGAGTTGTG TGG (reversed) Intronic
900645548 1:3707163-3707185 TCTCCCCACTTTGAGCTGTGAGG + Intronic
902923311 1:19680054-19680076 TCTACCACCTATGAGCTCTGGGG + Intergenic
903928535 1:26848983-26849005 TCCCCCAGCTCTGAGGTGTGGGG + Intronic
905922183 1:41727221-41727243 TTTCTCATCTATGAGATGGGAGG - Intronic
908417052 1:63923388-63923410 ACTCCGTTCTCTGAGTTGTGAGG + Intronic
910813923 1:91268444-91268466 TCTCTCATTTATTAGTTGTATGG + Intronic
911213704 1:95168934-95168956 TCTCCCAGCTAAGAGTTAAGGGG + Intronic
913419117 1:118644163-118644185 TCTACCAGTTATAAGTTGTGCGG - Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
919466517 1:197926752-197926774 TCTCTCAACTGTGAGCTGTGGGG + Intronic
919537804 1:198810094-198810116 TCTTCAGTCTATGACTTGTGAGG + Intergenic
920008167 1:202848663-202848685 TGTCCCATCTATGCGTTCTTGGG + Intergenic
920536179 1:206737936-206737958 TCTCACATCTATGCCTTGTTGGG + Intergenic
921245286 1:213232390-213232412 CCTCCCTACTTTGAGTTGTGAGG + Intronic
922040416 1:221890841-221890863 TCTCCCAGCTATGAATTATTTGG + Intergenic
923109766 1:230881480-230881502 TCTGCCACCTGTGAGTGGTGAGG - Intergenic
923357298 1:233171965-233171987 TCTCCCATGTGTGGGGTGTGTGG + Intronic
1064555930 10:16547229-16547251 TCTGCCACTTATGAGCTGTGTGG - Intergenic
1068636544 10:59354491-59354513 CCTCCCACTTATTAGTTGTGTGG + Intronic
1068947854 10:62747192-62747214 TCACCCATCTCTGAGTTTTCTGG + Intergenic
1071393012 10:85194506-85194528 TGTCCCATCAATGAGTGTTGCGG + Intergenic
1072218112 10:93305095-93305117 TCTACCATTTATTGGTTGTGTGG + Intergenic
1072370497 10:94761964-94761986 TCTGCCAGCTATGAGCTGTGTGG + Intronic
1072386694 10:94937940-94937962 TCTGCCAGCTATGAGCTGTGTGG + Intergenic
1074752156 10:116597014-116597036 TCTCCCACTGATGAGTTGTGTGG - Intronic
1075186296 10:120261478-120261500 TCTTTCGGCTATGAGTTGTGTGG + Intergenic
1076124564 10:127963603-127963625 TCTCCAATCCTGGAGTTGTGGGG + Intronic
1078483361 11:11699803-11699825 TCTTCCATTGATGAGCTGTGTGG - Intergenic
1084548573 11:69826939-69826961 TCTGCCATGTATGACCTGTGAGG + Intergenic
1088566607 11:111179122-111179144 TCTCCCTCTTATGAGCTGTGTGG - Intergenic
1089534670 11:119153754-119153776 ACGCCCATCCATGAGATGTGTGG + Intronic
1089701205 11:120245167-120245189 TCCCCCATCTATGTCTTGTTTGG + Intronic
1089787720 11:120920117-120920139 TCTGCCAGCTATGAGCTGTGTGG + Intronic
1090452415 11:126818402-126818424 TCTGCCATTTACTAGTTGTGTGG + Intronic
1092990912 12:13898393-13898415 TCTGCCATTTATTAGTTGTGTGG - Intronic
1093173950 12:15890272-15890294 TCTCCCTTCTATTAGTAGTTGGG - Intronic
1093639711 12:21512037-21512059 TTCTCCAACTATGAGTTGTGTGG - Intronic
1094357446 12:29593144-29593166 TCTGCCATCCGTGAGTTCTGTGG + Intronic
1094557265 12:31513632-31513654 ACCCCCATCTATGTGTTGTGTGG + Intronic
1095695430 12:45138484-45138506 TCTTCCACTTCTGAGTTGTGGGG + Intergenic
1102792988 12:115663298-115663320 TGTCTCATCTCTGAGTTGAGAGG - Intergenic
1103132714 12:118482853-118482875 TCTCCCATATATGAGTTCAAAGG + Intergenic
1103159445 12:118716181-118716203 TCTTCCAACTGTGTGTTGTGAGG - Intergenic
1104341183 12:127950542-127950564 TATTCAATCTATGATTTGTGGGG - Intergenic
1104510306 12:129371847-129371869 TGTCACATCCATGAGTTGTGAGG + Intronic
1105066429 12:133203492-133203514 TCTCCCCTGTATGAGTTCTCTGG - Intergenic
1105776617 13:23667993-23668015 GCTCCCATCCATGTGCTGTGAGG + Exonic
1107681438 13:42856002-42856024 TTTCCCATCTACAAGTTGGGAGG - Intergenic
1110731424 13:78882853-78882875 TCTCACATTTAAGAGATGTGGGG - Intergenic
1111955277 13:94750216-94750238 ACTCCCATCTATGAGTTCCATGG + Intergenic
1112108488 13:96268159-96268181 GCTCCAATCTATGAATTTTGGGG + Intronic
1113438621 13:110311536-110311558 ACCCCCATCTATGAGGTGGGTGG - Intronic
1114183867 14:20385781-20385803 TCTGTCATCTACAAGTTGTGTGG - Intronic
1116837757 14:49787652-49787674 GTTCCCATATATGAATTGTGGGG + Intronic
1119951179 14:78747104-78747126 TCTGCTATTTATGAGTTTTGAGG - Intronic
1121323059 14:93003910-93003932 TTTCCCATCTGTAAGATGTGTGG + Intronic
1121818311 14:96944911-96944933 TCTATCTTCTATCAGTTGTGTGG - Intergenic
1121830831 14:97050769-97050791 TCTCCCGTCTTTGAGGTGTAAGG - Intergenic
1121835464 14:97088357-97088379 TCTCCCATCCATGGGTTGTCTGG + Intergenic
1125041705 15:35195512-35195534 CCTGCCATCTATGAGTTCTCTGG - Intergenic
1125869903 15:43090761-43090783 TTTCTCATCTATGAAATGTGAGG - Intronic
1126579452 15:50229833-50229855 AATCCCAAATATGAGTTGTGGGG - Intronic
1126675190 15:51154932-51154954 TCTCCCTTTTATGACTTGAGAGG - Intergenic
1127228476 15:56961242-56961264 TCTCTCATCTATCAGATGTATGG - Intronic
1130102391 15:80903845-80903867 TCTCCCATCCATCAGCTCTGTGG - Intronic
1130886048 15:88093523-88093545 ACTGCCATTTATGAGCTGTGTGG - Intronic
1134022718 16:10932443-10932465 TCTGCCATTTATGAGCTGTGTGG - Intronic
1134624144 16:15712025-15712047 TCTCCCATAGATGGGATGTGGGG + Intronic
1137478946 16:48835138-48835160 TCTTCCATCTCTGAGATTTGAGG - Intergenic
1139188625 16:64836263-64836285 CCTCCCAGCTGTGAGGTGTGTGG - Intergenic
1140875186 16:79144304-79144326 TCTCCCATCTATCAGTTGAAGGG - Intronic
1140966908 16:79975768-79975790 CCTACCATCTATTATTTGTGTGG - Intergenic
1143918806 17:10314586-10314608 TCTCCCATCTTTCTGTTGTATGG - Intronic
1143958296 17:10692881-10692903 GCTCCCCAGTATGAGTTGTGAGG + Exonic
1144692127 17:17274198-17274220 TCTTCCAATTTTGAGTTGTGGGG + Intronic
1144853062 17:18253799-18253821 TCTGCCACCTCTGAGCTGTGTGG + Intronic
1148722104 17:49761564-49761586 TCTGCCATTTACTAGTTGTGTGG - Intronic
1149024628 17:52012322-52012344 TCTCCTACCTATCAGCTGTGTGG - Intronic
1151494650 17:74452234-74452256 GCTCTCTTCTATGAGCTGTGGGG - Intergenic
1152638837 17:81441157-81441179 TCTCCCATCTCTGAGGTGTGGGG + Intronic
1158075968 18:53530272-53530294 TCTCCCAATTATTAGCTGTGTGG - Intronic
1161506851 19:4648684-4648706 TTTCCCATCTGTGAGTCCTGAGG - Intronic
1166253392 19:41586181-41586203 GCTCTCATCTATGAGGTGAGTGG + Intronic
926091383 2:10052300-10052322 TCTCCCCTGTGTGAGTTCTGCGG - Exonic
926370564 2:12174706-12174728 TCTCCCATCTCTGATGTTTGGGG - Intergenic
926580767 2:14631952-14631974 ACTCACATACATGAGTTGTGAGG + Intergenic
926742224 2:16121577-16121599 TCACCAATCTTTGAGTTGTCTGG - Intergenic
929698029 2:44136441-44136463 ACTCCCATCTTTTAGTTTTGTGG + Intergenic
931679290 2:64730241-64730263 TCTCCCATCTAAAATGTGTGGGG - Intronic
933242850 2:79942303-79942325 TCTGCCATCTACCAGATGTGTGG - Intronic
935066960 2:99657582-99657604 TCTCCAATCTAAGAGGTTTGTGG + Intronic
936395159 2:112121125-112121147 TCTCCCACCTTTGACATGTGAGG + Intergenic
938394706 2:130935394-130935416 TCTTCCATCTATTAGCTTTGGGG + Intronic
938605568 2:132889195-132889217 TCTCCAATCTATGTGATGTTGGG - Intronic
941509166 2:166384377-166384399 TCTTCCATATATTAGCTGTGTGG - Intergenic
942157953 2:173151032-173151054 TCTATCATGTATGAGCTGTGTGG - Intronic
947328298 2:229001673-229001695 GCTTCAATATATGAGTTGTGGGG - Intronic
947836814 2:233181737-233181759 TCTCCCACCGATGAGCTGAGTGG + Intronic
1168926654 20:1587342-1587364 TCTGCCCTCTAGGACTTGTGAGG + Intronic
1172030133 20:31975970-31975992 TCTGCCACATATGAGCTGTGTGG + Intronic
1174706816 20:52664812-52664834 TCTGCCATTTATGAGATCTGTGG - Intergenic
1174993776 20:55543064-55543086 TCTACCATATCTGATTTGTGTGG - Intergenic
1175091735 20:56510573-56510595 TCTGCCCCCTATGAGTTGGGTGG - Intronic
1175547263 20:59786360-59786382 TCTCACATCATTGAGTTGTCAGG - Intronic
1176840548 21:13838928-13838950 TCTCCCAAACATGAGTTATGTGG - Intergenic
1179270814 21:39849694-39849716 TCTTTCATTTCTGAGTTGTGGGG + Intergenic
1179837739 21:44048374-44048396 TTTCCCATCTCTGAGTGTTGAGG + Intronic
1181830152 22:25554177-25554199 TCTCCCATCTACTAATGGTGTGG - Intergenic
1181915095 22:26273572-26273594 CCTCCATTCTTTGAGTTGTGGGG - Intronic
1182163169 22:28144222-28144244 TCTGCCATTTATGAGCTGTGTGG - Intronic
1183650180 22:39149137-39149159 CCTCCCATCTCGGAGTTGGGAGG - Intronic
951934562 3:28007362-28007384 TTTCTCATGTATGAATTGTGAGG - Intergenic
956891999 3:73622648-73622670 CCTCCCAACTAAGAGTTATGGGG + Intronic
958429696 3:94023644-94023666 TCTGCCACCTTTTAGTTGTGTGG - Intronic
958983286 3:100750661-100750683 CCTTCAATCTATGAGCTGTGAGG - Intronic
959074393 3:101734929-101734951 TCTGCTATCTATTAGCTGTGTGG + Intronic
960548351 3:118944414-118944436 TCTCCCATCTAAGATTTATGTGG + Intronic
961784550 3:129340182-129340204 CCGCCCATCTCTGAGATGTGGGG - Intergenic
964381379 3:156101352-156101374 TCTCCCTTCTCTGATTTCTGTGG - Intronic
964708961 3:159651401-159651423 TCTCCCATAGATGAGCAGTGTGG + Intronic
970392579 4:15630086-15630108 TCTCTCATTTGTGAGTTGTTTGG + Intronic
971007585 4:22392297-22392319 TCTCCCATCCTCGAGTTGTGAGG - Intronic
971549572 4:27934134-27934156 TCTCCCATCTATCACTGATGAGG + Intergenic
973645109 4:52942506-52942528 TCTGCCATTCATTAGTTGTGGGG + Intronic
973733003 4:53841828-53841850 TCTCCCGTGTAGGAGTTGAGTGG - Intronic
974374606 4:61060688-61060710 TCTTTCTTGTATGAGTTGTGAGG + Intergenic
974374845 4:61062562-61062584 TCTTTCTTGTATGAGTTGTGAGG + Intergenic
975532988 4:75420385-75420407 TCTCCCATTCAGGAGGTGTGGGG + Intergenic
976889687 4:90031577-90031599 TCTGCCATTGATCAGTTGTGTGG + Intergenic
977535315 4:98250508-98250530 TCTCCTCTCTATGAAATGTGTGG - Intergenic
977992230 4:103458177-103458199 TCTCACATTTATGAGTCATGTGG + Intergenic
979290241 4:118971861-118971883 TCTCCCATCCATGAGAGGGGTGG + Intronic
979602346 4:122600218-122600240 TCTCCAATCCATGAGATGTAGGG - Intergenic
988277497 5:29100385-29100407 TCTCCCAGCAATGAGTCATGAGG - Intergenic
990315951 5:54583570-54583592 TTTCCCACCTATTAGTCGTGTGG + Intergenic
990960497 5:61388656-61388678 TCTGCCATTTATTAGTTGTGTGG - Intronic
996204747 5:120718742-120718764 TCTCCTACCAATGAGTTATGAGG + Intergenic
997837605 5:137208383-137208405 TCTCCCATCTATGAGTTGTGTGG - Intronic
997979563 5:138460305-138460327 TCTCCTCTCTATGAGCTGTGAGG + Intergenic
998006214 5:138658719-138658741 TCTCTCATCTATGAAATGTGCGG + Intronic
998613614 5:143716143-143716165 TCTGCCATTTAGGAGCTGTGTGG + Intergenic
1003597937 6:7491123-7491145 TCTCCTACCTATGATTTTTGTGG + Intergenic
1005097791 6:22136937-22136959 TCTCCCATGTGTTAGCTGTGTGG + Intergenic
1005850597 6:29817902-29817924 TCTCCCAACAATGGGCTGTGCGG + Intergenic
1005857801 6:29876165-29876187 TCTCCCTTCTTTGATTTGTAAGG + Intergenic
1006847611 6:37073647-37073669 TTTCCCCTCTATTAGTTGGGAGG + Intergenic
1007096853 6:39218575-39218597 CCTCCCTTCTATGACTTTTGTGG - Intronic
1007374150 6:41444922-41444944 TCTCCCGTCTCTGAGTGTTGGGG + Intergenic
1007387381 6:41528945-41528967 TTTCTCATCTATAAGGTGTGTGG + Intergenic
1015537489 6:134281279-134281301 TCTACCACCTATTAGATGTGTGG + Intronic
1015970850 6:138741481-138741503 TCTGCCATCTTTGAGATGTTAGG + Intergenic
1018994818 6:168702692-168702714 TTTCCCATCTGTAAGTTCTGGGG - Intergenic
1021199891 7:17716990-17717012 TCTCCCATGAATCAGTTTTGTGG + Intergenic
1021206184 7:17784146-17784168 GCTCCCACATATGAGTTGGGAGG + Intergenic
1023792124 7:43761072-43761094 TCTTCCGTCTTTGAGCTGTGAGG + Intronic
1024959952 7:54963599-54963621 TCTGCCATTTATCAGCTGTGAGG - Intergenic
1025090111 7:56055308-56055330 GCTACCATCTGTGAGTTGTTGGG + Intronic
1025832584 7:65065942-65065964 GCTACCATCTGTGAGTTGTTGGG + Intergenic
1025902357 7:65755469-65755491 GCTACCATCTGTGAGTTGTTGGG + Intergenic
1027160046 7:75795806-75795828 TCTGCCATCCATGAGTTTTGTGG - Intergenic
1027166686 7:75839583-75839605 ACTCCTAACTATGAGTTGTTTGG - Intergenic
1027337909 7:77173672-77173694 ACTCCCATCAATGGGCTGTGTGG + Intronic
1029777826 7:102697139-102697161 ACTCCCATCAATGGGTTGTGTGG - Intergenic
1036590350 8:10162822-10162844 TCTCCCACCTATGACCTGTGTGG - Intronic
1036751298 8:11445152-11445174 TCTCCCAGCAATAAGTTGTGGGG + Intronic
1036769738 8:11570841-11570863 TCTGCCATTTATCAGCTGTGTGG - Intergenic
1037647191 8:20803117-20803139 TCCCCCATCTATCCATTGTGAGG - Intergenic
1038906683 8:31912304-31912326 TTTACTATCTAGGAGTTGTGGGG + Intronic
1039199994 8:35080854-35080876 TCTTCCATCTATAATTTGTAGGG - Intergenic
1041168586 8:55116755-55116777 TCCCCCATCTATGTGCTGGGAGG + Intronic
1041414188 8:57589481-57589503 TTTAGTATCTATGAGTTGTGTGG - Intergenic
1043402016 8:79892824-79892846 TCTGCCACCTATGAACTGTGAGG - Intergenic
1045866299 8:106869590-106869612 TCTACCATCTACTAGCTGTGTGG - Intergenic
1048325689 8:133437193-133437215 TCTCCCATCTGTAAGATATGGGG - Intergenic
1051249362 9:15143883-15143905 TCACCCATTTATCAGGTGTGTGG - Intergenic
1053456088 9:38234057-38234079 AGTCCCATCTTTGAGATGTGGGG - Intergenic
1057702290 9:97372074-97372096 TCTCTGATCTGTAAGTTGTGAGG - Intronic
1058443953 9:105037001-105037023 TCTCCCACTAATGAGTTGTTTGG - Intergenic
1058746884 9:108000360-108000382 GTTCCCATCTCTGAGCTGTGTGG - Intergenic
1060458700 9:123826761-123826783 TCACCCATTTATCAGGTGTGAGG + Intronic
1060940356 9:127539865-127539887 TCTGCCACCTATGAGCTGTGTGG + Intronic
1185787319 X:2901840-2901862 TCTTCCACATATGAATTGTGGGG - Intergenic
1185992758 X:4910652-4910674 TCTCCCATCTGTGAGCTGAAAGG - Intergenic
1188628415 X:32317644-32317666 TGGCCCATTTATGAGTTATGAGG + Intronic
1188750675 X:33902026-33902048 TCTCACATCTGTGAATTGTTTGG - Intergenic
1190088038 X:47412949-47412971 TCTCCCCTGTATGAGTTCTGTGG - Exonic
1192247264 X:69384117-69384139 TCTCCCAGCTGTGAGTGCTGTGG + Intergenic
1193493426 X:82179753-82179775 TTTCCAATCTATGAGATGGGAGG + Intergenic
1193962582 X:87944367-87944389 TATCTCATCAATTAGTTGTGGGG + Intergenic
1194764948 X:97838834-97838856 TCTACCATTTACTAGTTGTGCGG - Intergenic
1195836741 X:109124223-109124245 TCTGCCACTTATCAGTTGTGTGG - Intergenic
1199208940 X:145183324-145183346 TTTCCCATATATGAAGTGTGTGG - Intergenic