ID: 997839265

View in Genome Browser
Species Human (GRCh38)
Location 5:137224087-137224109
Sequence GAGGCTGGTTCTTTGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997839265 Original CRISPR GAGGCTGGTTCTTTGGAAAG AGG Intronic
900736070 1:4300276-4300298 GAGGCTGGCTCTGGGGAGAGAGG + Intergenic
901329032 1:8390322-8390344 GAAGCTGCTTATTTGGAGAGTGG + Intronic
901526244 1:9824698-9824720 GATGCTGGTTCTTAGAAATGCGG + Intergenic
901739782 1:11334580-11334602 GAGGGTGGTTATTGGGAAACAGG + Intergenic
902200210 1:14827602-14827624 GAGGAGGGTTGTTGGGAAAGAGG + Intronic
902447865 1:16478522-16478544 GAGGCAGGTTCCTTGGAAAACGG - Intergenic
903269232 1:22177409-22177431 GAGGCAGGCTCTTGGGAAAGAGG + Intergenic
905123780 1:35702787-35702809 GAGGCTGGTTCTCAGGATTGAGG - Intergenic
905476181 1:38229748-38229770 GAGGCTGGTCCTTCAGAATGAGG + Intergenic
905972599 1:42153277-42153299 GGGGCTGGTTCCTAGGAAGGGGG - Intergenic
906878000 1:49558843-49558865 GAGGCTCATCCTTTGGAAAAAGG + Intronic
907353401 1:53852231-53852253 GAGCATGGTTCTTTGGGAAGTGG - Exonic
908789691 1:67769421-67769443 GAGGGTGGGTCTTTGGAGGGAGG + Intronic
912697791 1:111854600-111854622 GAGGCTGGTTCTCTGAGGAGTGG + Intronic
913675646 1:121137946-121137968 GAGGCTGTTGTTTTGGAGAGAGG + Intergenic
914027544 1:143925887-143925909 GAGGCTGTTGTTTTGGAGAGAGG + Intergenic
915405990 1:155660088-155660110 GGGGCTGGTTCAATGGACAGGGG + Exonic
915443045 1:155958455-155958477 AAGCCTGGTCCTTGGGAAAGAGG - Intronic
917031167 1:170693428-170693450 GAGGCAGGCTCTCAGGAAAGAGG + Intronic
917845504 1:179016867-179016889 GAGGCTGTCTGGTTGGAAAGGGG - Intergenic
917963367 1:180163700-180163722 GAGGCTGGATATGTGGACAGGGG + Intronic
918725375 1:187914993-187915015 AAAACTTGTTCTTTGGAAAGTGG + Intergenic
918914677 1:190619704-190619726 GATGCTGCTTCTTTATAAAGAGG + Intergenic
919299409 1:195741493-195741515 GAATCTGGATCTTTGGAAGGAGG + Intergenic
921113986 1:212069286-212069308 GAGGCTGGTGATTTGGAAGAGGG - Intronic
921586873 1:216957639-216957661 GATGCTGGTGCTGTGGATAGAGG - Intronic
1064715341 10:18171244-18171266 TAGGGTTATTCTTTGGAAAGGGG + Intronic
1064843863 10:19629120-19629142 GAGGCTTGCTTTTTGGGAAGGGG - Intronic
1065180325 10:23118483-23118505 GAGGGTGGGTCTTTGGTGAGTGG + Intronic
1068073831 10:52229421-52229443 GAGGGTGGTTCATTGGGAAATGG - Intronic
1068127031 10:52852605-52852627 GAGGCTGGTTCATTGGTAATGGG + Intergenic
1070531305 10:77339650-77339672 TAGGCTGGTTTGTTGGAAGGTGG + Intronic
1070718595 10:78740424-78740446 GAGGCTGGTGCTTGGGTAGGGGG - Intergenic
1070745705 10:78932439-78932461 GAGGCAGGCTGTTTGGAAGGAGG - Intergenic
1071055173 10:81501836-81501858 GGGTCTTGTTCTTTGGAAAGTGG - Intergenic
1072365514 10:94704772-94704794 GAGACAGTTTCTTTGGAAAATGG - Intronic
1073486559 10:103822716-103822738 GAGGATTGTTCCTTGGAGAGAGG - Intronic
1074941351 10:118238699-118238721 GAAGCTGGTTCCCTGGAAATTGG - Intergenic
1075427539 10:122353460-122353482 GAGACTGGTCATTTGCAAAGGGG - Intergenic
1076621116 10:131788837-131788859 CAGGCTGTTTCTTTGGGCAGGGG - Intergenic
1077697859 11:4411546-4411568 TAGCCTGGCTCTTTGGAAAGAGG + Intergenic
1078008147 11:7547898-7547920 GAGGCTGGTTCGTTTGGAGGCGG - Intronic
1081710661 11:45213438-45213460 GATGCTGCTTCTTTTGAAGGGGG + Intronic
1081782674 11:45724029-45724051 GAGGCAGGTGCTTTGACAAGTGG - Intergenic
1081832163 11:46122379-46122401 AAGGGTAGTTATTTGGAAAGGGG - Intergenic
1083325370 11:61870319-61870341 GAGGCAGCTTCTTTGGCCAGAGG - Intergenic
1085715856 11:78872589-78872611 GAGGCTGGTCCTTTGCAAGTTGG - Intronic
1088909442 11:114179862-114179884 GAGGGAGGTTCTTTGACAAGGGG + Intronic
1089843283 11:121437669-121437691 GAGTCTGGCTCTTTGAACAGGGG - Intergenic
1091565202 12:1642916-1642938 GAGGCCTGTTCCTTGGAGAGAGG - Intronic
1095448103 12:42302459-42302481 GTGGCAGGGTCTTGGGAAAGAGG + Intronic
1096079730 12:48825382-48825404 GAGGCTGCTTCTCTCCAAAGGGG + Intronic
1098664390 12:73142930-73142952 GAGTCTTGATCTTTGGAAACAGG - Intergenic
1099665036 12:85617693-85617715 AAAGCTGGTTGTTTGGAATGTGG - Intergenic
1102897028 12:116606564-116606586 GAGGATGGTTCTTTGAAAGAGGG - Intergenic
1104401827 12:128482752-128482774 GAAGCTGGGGCTTTGGGAAGAGG - Intronic
1104794627 12:131508803-131508825 GAGCTTATTTCTTTGGAAAGAGG - Intergenic
1105064659 12:133185858-133185880 TATGCTGGTTCTTAGAAAAGAGG - Intronic
1106344073 13:28859048-28859070 CAGGCTGCTTTTTGGGAAAGGGG + Intronic
1107049942 13:36036153-36036175 GAGGTTGTTTCCATGGAAAGGGG - Intronic
1107333333 13:39325812-39325834 GTGGATCTTTCTTTGGAAAGAGG + Intergenic
1108687476 13:52833285-52833307 GTGGCTGGCATTTTGGAAAGGGG - Intergenic
1112329525 13:98466450-98466472 GTGGGTTGTTCTTTGGAATGAGG + Exonic
1113188618 13:107718359-107718381 GAGGCAGGTTCTGTGGGAACTGG - Intronic
1116813091 14:49557904-49557926 GAGGCTGGCCCTTAGGAATGGGG - Intergenic
1118200761 14:63670150-63670172 GAGGCAGTTTTTTTGTAAAGGGG - Intergenic
1118508511 14:66443771-66443793 GAAGCTGGTACTTGGGAAACAGG + Intergenic
1119103602 14:71903532-71903554 GAGGGTGGTTCTTGAGAGAGAGG + Intergenic
1119505171 14:75166474-75166496 GAGTCTGGTTTCTAGGAAAGTGG - Intronic
1121633748 14:95439870-95439892 AAGGCTGCTTCTTTGGGAAGTGG + Intronic
1122349383 14:101078621-101078643 GGGGCTGGGGCTTTGGAAGGAGG - Intergenic
1124068246 15:26366330-26366352 TAGGCTTGTTCTTTCTAAAGAGG + Intergenic
1126063676 15:44808569-44808591 GAGGCTGGTACCTAGGAGAGGGG - Intergenic
1126971374 15:54115943-54115965 GTGGCATCTTCTTTGGAAAGCGG - Intronic
1128870376 15:71150706-71150728 AAGGATGGTTTTTTGGAGAGGGG + Intronic
1129876957 15:78981934-78981956 GAGGGTGCTGCTCTGGAAAGGGG - Intronic
1130544137 15:84842404-84842426 GAGACTGTTTCTTAGGATAGAGG + Intronic
1130775978 15:86983695-86983717 GAGGCTGGAGATTAGGAAAGGGG - Intronic
1131158746 15:90090836-90090858 GAGGCTGGGGCTTTGGAGAGAGG + Intronic
1131342961 15:91619884-91619906 GAGGCTGGGTGTCTGGAGAGGGG + Intergenic
1131739606 15:95373732-95373754 GAGACTGATTCTTAGGAAGGAGG - Intergenic
1132177017 15:99724085-99724107 GTGGATGGTTCTTTTCAAAGAGG - Intronic
1132650402 16:1019017-1019039 GAGCCTGGTCCTTTGAAATGTGG + Intergenic
1134615929 16:15650857-15650879 CAGGGTGGGTTTTTGGAAAGAGG - Intronic
1135218875 16:20595815-20595837 GAGGGTGGTTATTGGGAATGTGG + Intergenic
1135336762 16:21608238-21608260 TAAGCTGGTTGTTTGGAGAGAGG + Intronic
1135656180 16:24252324-24252346 GAGGATAGTTCTTAGAAAAGGGG - Intergenic
1137519316 16:49178603-49178625 GAGGCTGACTCTTTGGGAAAGGG - Intergenic
1137575188 16:49594915-49594937 GAGGCTGGTTCTTACAAAACTGG + Intronic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1141089478 16:81120454-81120476 GAGGCTGATGCTGTGGATAGGGG + Intergenic
1144007087 17:11110566-11110588 GAGGTGGGGTCTTTGGAAGGTGG + Intergenic
1145897289 17:28466519-28466541 GAGGAGGATTCTTTGGCAAGAGG + Intronic
1148335200 17:46836213-46836235 TTGGCTGCTTCCTTGGAAAGGGG - Intronic
1148719017 17:49737376-49737398 GAGGCAGGGACTCTGGAAAGTGG + Intronic
1154917856 18:20756214-20756236 CAAGCTGTTTCATTGGAAAGGGG + Intergenic
1154920013 18:20789896-20789918 CAAGCTGTTTCATTGGAAAGGGG + Intergenic
1156344778 18:36247049-36247071 GGGGCTGGTTCTTGGGCAAATGG + Intronic
1156622748 18:38872537-38872559 GAGGCTGGACCTTTTGAAATTGG - Intergenic
1160076319 18:75680860-75680882 GAAGCTGATGCTTTGGAAAGTGG + Intergenic
1165913430 19:39243898-39243920 GAGGCTGGATCTGTGGGCAGAGG + Exonic
1165917525 19:39269725-39269747 GAGGCTGGATCTGTGGGCAGAGG - Exonic
1167100863 19:47403544-47403566 GAGGCTGGGTCTGTGGAGAGGGG + Exonic
1167234169 19:48303722-48303744 GAGGCTGGTGCTTTGCTACGAGG - Exonic
1167811321 19:51833796-51833818 GAGGCTGGAATTTTGGGAAGTGG + Intergenic
1168583226 19:57572545-57572567 GAGGGTGGTTCTTTGGCTAAAGG + Exonic
925775733 2:7333628-7333650 GAGGCTGGCTCAGTAGAAAGTGG + Intergenic
926111889 2:10188912-10188934 GAGGCTGGATCATTGGAGGGAGG + Intronic
926304503 2:11628209-11628231 GAGGCTGGTTATTTATAAACAGG + Intronic
926484604 2:13438981-13439003 GAGGCTGGGTTTTTGGAAGAGGG - Intergenic
928306523 2:30174394-30174416 GAGGTTGTTTCTTTGTAATGAGG - Intergenic
928363082 2:30681109-30681131 GAGGCTGGTAATTTATAAAGAGG + Intergenic
929746617 2:44666116-44666138 TAGGTTTGATCTTTGGAAAGAGG + Intronic
929815993 2:45232072-45232094 GAGGTGGGGTCTTTGGAAGGTGG - Intergenic
929908314 2:46065990-46066012 GATGCTGGATCTTTGCAAATGGG - Intronic
932270049 2:70401304-70401326 GAGGATGGTTGAGTGGAAAGTGG + Intergenic
934115447 2:88786953-88786975 GAGCATGTTTCTATGGAAAGGGG + Intergenic
934628137 2:95881982-95882004 GAGCATGTTTCTATGGAAAGGGG - Intronic
934805269 2:97217670-97217692 GAGCATGTTTCTATGGAAAGGGG + Intronic
934832090 2:97537848-97537870 GAGCATGTTTCTATGGAAAGGGG - Intronic
937875497 2:126822606-126822628 GAGATTTGTTTTTTGGAAAGAGG + Intergenic
943152376 2:184130721-184130743 GAGGCTGGCTCACTTGAAAGAGG + Intergenic
944219393 2:197287168-197287190 GAGGCTGGTTGTGGGGACAGGGG + Intronic
944676489 2:202036803-202036825 GTGGCTGCTTTGTTGGAAAGAGG + Exonic
944924514 2:204450753-204450775 GAGACTAGTTCTGTGGAATGAGG - Intergenic
945011058 2:205464164-205464186 TAGGTTGGTTCCTTGGAAAAAGG + Intronic
945019456 2:205556644-205556666 GAGGGTGCTGTTTTGGAAAGCGG + Intronic
947232636 2:227903388-227903410 GAGGCTGGCACTTTTGGAAGAGG + Intronic
948364682 2:237447041-237447063 GAGGTGGGGTCTTTGGGAAGGGG - Intergenic
948783910 2:240341052-240341074 GAGGCTTGTGCTTTGATAAGGGG - Intergenic
1169089263 20:2848041-2848063 GAGGCTGGTGCACTGGAAGGTGG - Intronic
1171416516 20:24985113-24985135 CTGGCTGGTTGTTGGGAAAGAGG - Intronic
1172614683 20:36275343-36275365 GAGGCTGGGGCTCTGGAAGGAGG + Intergenic
1173538919 20:43837049-43837071 GAGGCAGGTTCTTTGCAGCGTGG - Intergenic
1174753375 20:53134511-53134533 GAAGCTGGGCATTTGGAAAGGGG + Intronic
1174846688 20:53949602-53949624 GAGGCTTGGTCTTTGGAAAGCGG + Intronic
1175005241 20:55674801-55674823 GAGGCTGGTGCTTTTACAAGAGG + Intergenic
1177431974 21:21001064-21001086 GAAGCTATTGCTTTGGAAAGTGG + Intronic
1180694447 22:17742875-17742897 GGGGCTGCTTCTATGGACAGGGG - Intronic
1180720674 22:17906006-17906028 GAGTATGGAACTTTGGAAAGAGG + Intronic
1181110388 22:20599285-20599307 GAGGCTGGCACTTTGGAGGGTGG - Intergenic
1182243998 22:28940703-28940725 GAGTCTGATTCTTTGGATAGGGG + Intronic
1182437367 22:30339342-30339364 GAGGCTGGTTCCATGGGATGAGG + Intronic
1182776732 22:32837001-32837023 GAGGGTGGTTCTTTGGCTAATGG + Intronic
1183324927 22:37185981-37186003 GAGGCTTGTTCTCAGGAGAGGGG + Intronic
1184146956 22:42617405-42617427 GAGGCTGCCTCCTGGGAAAGGGG - Intergenic
1184357477 22:43992208-43992230 GGGGATGGTGCTTTGTAAAGGGG + Intronic
1185413255 22:50697027-50697049 GAGCCTGGCTCTTGGAAAAGCGG + Intergenic
949941483 3:9158238-9158260 GAAGCTGGTTCTTTACAAGGAGG + Intronic
950490273 3:13300473-13300495 GAGGTTGGGTCTTTGGGAGGTGG - Intergenic
950951603 3:17005775-17005797 GAGGTAGGTTCTTTGGAAGCCGG + Intronic
951678954 3:25274539-25274561 GAGCCTGGCTCCCTGGAAAGGGG + Intronic
952523686 3:34187337-34187359 GAGGCTGGTGCCTAGGAAAGTGG + Intergenic
953251208 3:41247050-41247072 GAGGCTGGCCCCTTTGAAAGGGG - Intronic
953725956 3:45399073-45399095 GAAGCTGCTTCTTTGGAAGCTGG + Intronic
954586851 3:51743894-51743916 GTTGCTGGTTCTTGGGCAAGAGG + Intergenic
954961107 3:54565747-54565769 AAGGCTGGTCCCTTGGAAACGGG - Intronic
956658548 3:71577248-71577270 GAGGCTGGTATTCTGCAAAGAGG - Intronic
956715409 3:72075562-72075584 GGGGCTGGTTCTTCCGATAGTGG - Intergenic
958925121 3:100149262-100149284 GCCTCTGGTTCTTTGTAAAGTGG - Intronic
961083046 3:124042816-124042838 GAGTCTGGAGCTTTGGAAGGAGG + Intergenic
962043937 3:131735848-131735870 GAGGCAGGGTCTATGGAAATTGG - Intronic
965472663 3:169114993-169115015 GGGTCAGGTTCTTTGGAATGGGG - Intronic
965558534 3:170040363-170040385 GACGCTCGTTCTTTGTAAATTGG + Intronic
965719936 3:171650485-171650507 GGCCCTGGATCTTTGGAAAGGGG - Intronic
967187988 3:186961658-186961680 GAGGCTGGTCAGCTGGAAAGGGG + Intronic
967933429 3:194707279-194707301 TAGGCTGGTTCTTGGCAAACCGG - Intergenic
968117907 3:196103749-196103771 GAGGCTGGTTCCTTTGCAATGGG - Intergenic
969445414 4:7242127-7242149 GTGGCTGGTCCTTAGGAAAGCGG + Intronic
969835579 4:9837521-9837543 GAGGCTGGTACAATGGAATGCGG + Intronic
970130644 4:12866391-12866413 AAGGCTGTTTGTGTGGAAAGAGG + Intergenic
970680603 4:18503166-18503188 CAGACTGCTTCTGTGGAAAGTGG + Intergenic
971461418 4:26902214-26902236 GAGGTTGTTTCTTAGGGAAGTGG + Intronic
971749691 4:30631579-30631601 GAAGCTGTTGCTTTGGACAGTGG - Intergenic
975046511 4:69811002-69811024 AAGGATGGTTCCTAGGAAAGGGG - Intronic
978506944 4:109468423-109468445 GAGGCTGATACTCTGGAGAGGGG - Intronic
980975356 4:139605540-139605562 GAGGCCGGTGCTTGGGTAAGGGG + Intronic
982202412 4:152973563-152973585 GTGCCTGGCTCTTTGGACAGTGG - Intronic
982204013 4:152983510-152983532 GAGCCTGATTCTTTCCAAAGTGG + Intergenic
982503986 4:156195247-156195269 GAGGATTGTTCTTAGAAAAGAGG + Intergenic
983078446 4:163354912-163354934 GATGCTGGCTTTCTGGAAAGTGG + Intergenic
985947136 5:3194545-3194567 GGGGCTTGTTGTTTGGAAATCGG + Intergenic
986214700 5:5708470-5708492 GAGGCTGGTTGGTCTGAAAGAGG - Intergenic
987676333 5:21077353-21077375 GAGGCTGCTTCTTTGGACAAAGG + Intergenic
990200467 5:53367066-53367088 GATGCTGGTTCTTAAGAAATAGG - Intergenic
990507691 5:56460725-56460747 GAGCCTGGTTCTTTTGTCAGGGG + Intronic
992501074 5:77344641-77344663 GAGGCAGGGCCTTTGGGAAGTGG - Intronic
994355195 5:98786844-98786866 GAAACTGGTTCTATGGAGAGAGG + Intronic
995027146 5:107437317-107437339 GTGGCTGTTTCTATGGAAATTGG + Intronic
997369943 5:133353168-133353190 GAGGGTGTTTATTTGTAAAGGGG - Intronic
997700908 5:135898773-135898795 GAGGATGGTGATGTGGAAAGTGG + Intergenic
997700918 5:135898850-135898872 GAGGATGGTGATGTGGAAAGTGG + Intergenic
997839265 5:137224087-137224109 GAGGCTGGTTCTTTGGAAAGAGG + Intronic
1000139208 5:158385121-158385143 GAGGCTGCTTCTCTGAAATGGGG - Intergenic
1001152644 5:169245624-169245646 GAGAATGTTTCTTTAGAAAGTGG + Intronic
1001414843 5:171538186-171538208 GTGGCTGTCTCTTAGGAAAGAGG - Intergenic
1001533201 5:172479397-172479419 GGGGCATGTTCTTTGGAAGGCGG - Intergenic
1001759823 5:174198185-174198207 GCTGCTGCTTCCTTGGAAAGTGG + Intronic
1002343796 5:178534336-178534358 GAGGCGGGGCCTTTGGAAGGTGG - Intronic
1002607477 5:180391626-180391648 GAGGCTGGGGGTTTGGTAAGGGG - Intergenic
1003174204 6:3743255-3743277 GAGGCCTGTTCTTTGGGTAGTGG - Intronic
1005314832 6:24594888-24594910 GAGGTTGCTTGTTTGGAAACTGG - Intronic
1007957639 6:45932013-45932035 GAGGCTGGATCTTTGGAGGCAGG - Intronic
1008484484 6:52020628-52020650 GCGGGTGGTTCTTTGGAAAGTGG - Intronic
1009417336 6:63430235-63430257 GAGGCTGGAGCTTTGGAGAAGGG - Intergenic
1009454953 6:63845643-63845665 GAAGCTGCTTCTTTGGAAATGGG + Intronic
1011074276 6:83421393-83421415 GGGTCTGGTTCTGTGCAAAGTGG + Intronic
1013366804 6:109443203-109443225 GGAGCTGGTTCTCTGGGAAGAGG + Intronic
1014369824 6:120590813-120590835 CAGGCTGGTTCTTTGGTATGGGG - Intergenic
1016351941 6:143177899-143177921 CAGGCTGGTTCTTTGGCACCTGG + Intronic
1016465872 6:144324899-144324921 GAGGTTGGTTCAGGGGAAAGTGG + Intronic
1016541145 6:145166424-145166446 AAAGCTGGTTCTTTAAAAAGAGG - Intergenic
1018394410 6:163366598-163366620 CAGGCAGAATCTTTGGAAAGTGG - Intergenic
1018479017 6:164171449-164171471 GAGTCTGGTTCCATGGAAAAGGG - Intergenic
1020434051 7:8143277-8143299 GAGGCACCTTCTTTGTAAAGGGG + Intronic
1021236849 7:18153105-18153127 AAGGTAAGTTCTTTGGAAAGGGG + Intronic
1022080258 7:27012952-27012974 GAGGCTCCTCCTTTGGAAAGGGG + Intergenic
1022333003 7:29397894-29397916 GAGGCTCATTTTCTGGAAAGAGG - Intronic
1027733323 7:81903127-81903149 GAGGGTGGTTCTTAGGCCAGTGG + Intergenic
1028827638 7:95291703-95291725 GAAACTTGTCCTTTGGAAAGTGG - Intronic
1030742266 7:113124109-113124131 GAGGCTGATTATTTGGGAAGTGG + Intergenic
1031876523 7:127147972-127147994 GATGCTGGTTCAATGGCAAGGGG - Intronic
1032519589 7:132533865-132533887 GGGTCTGGTTCTGTGGGAAGTGG - Intronic
1034698809 7:153078752-153078774 GAGGATGGTTCTTTGACTAGGGG + Intergenic
1037995689 8:23350849-23350871 GAGGCTGCTTTTTTGGAGAACGG + Intronic
1039351654 8:36770164-36770186 GAGGCTGCTTCTCTGTAAAGAGG - Intergenic
1040385823 8:46914379-46914401 GAGGCTGGATGTTTGAAGAGAGG - Intergenic
1043620549 8:82186786-82186808 GAAGCAGTTTCCTTGGAAAGGGG + Intergenic
1043851566 8:85222036-85222058 GTGCCTGGTTTGTTGGAAAGAGG - Intronic
1045650918 8:104341039-104341061 GAGGCAGGAGCTTTGGAAATGGG + Intronic
1046143240 8:110121703-110121725 GAGGCTGTGCCTATGGAAAGGGG + Intergenic
1046376128 8:113383476-113383498 GAGCCTGGTTGAGTGGAAAGAGG + Intronic
1046661676 8:116954217-116954239 GAGGATGGGACTTTGGAATGGGG + Intronic
1047087100 8:121529929-121529951 GAGTTTAGTTCTTTGTAAAGTGG + Intergenic
1050562404 9:6847716-6847738 GAAGCTTGTTATTTGGAAACTGG - Intronic
1052064702 9:24003568-24003590 GATGCTTGTTCATTAGAAAGTGG - Intergenic
1056295289 9:85187088-85187110 AAGGATGTTTCTTTGGAAAGAGG + Intergenic
1056702287 9:88920796-88920818 AGGGCTGGGTCTTTGGAAACAGG - Intergenic
1058103022 9:100937802-100937824 AAGGCTGGTTCCCTGGAAACTGG + Intergenic
1058412473 9:104748308-104748330 GAGGCCGGTTCCGTGGCAAGCGG - Intronic
1058889261 9:109346834-109346856 GAGGATGGTTCGTTGATAAGGGG + Intergenic
1060753701 9:126193111-126193133 GAGGCTAGGTCTTGGGTAAGTGG - Intergenic
1061615450 9:131775992-131776014 GAGGTTAGGTCTTGGGAAAGTGG - Intergenic
1186314084 X:8349985-8350007 GTGGCTGGCTGTTGGGAAAGAGG + Intergenic
1187554958 X:20342766-20342788 GAGGATGCTTCTCTGGAATGTGG + Intergenic
1187744190 X:22390298-22390320 GAGGCTGGTCCGTTTGAAAGAGG + Intergenic
1188559419 X:31450904-31450926 GAGGGAGGTTCTCTGGAAAGGGG + Intronic
1189375945 X:40466443-40466465 GGGGCAGGATCTTTGGAAAGGGG + Intergenic
1189898950 X:45686121-45686143 GAGTCAACTTCTTTGGAAAGTGG + Intergenic
1192467219 X:71366080-71366102 GAGGATGGATATGTGGAAAGCGG - Intergenic
1195925243 X:110018062-110018084 GATGTTGGTTGTTTGGAAATGGG + Intronic
1198406007 X:136313232-136313254 GATGCAGCTTCTTTGGAAAATGG - Intronic
1198486159 X:137089580-137089602 GTGGCTGGATCTATGGAATGTGG + Intergenic
1199980657 X:152918679-152918701 GAGGAGGGTTCTCTGGACAGAGG + Intronic
1200426408 Y:3025523-3025545 AAAGCTGGTTCTTTCAAAAGAGG - Intergenic
1200573007 Y:4856019-4856041 TATGCTCCTTCTTTGGAAAGAGG - Intergenic
1201261111 Y:12159916-12159938 GGGGCTGATTGTTTGGGAAGGGG - Intergenic