ID: 997840315

View in Genome Browser
Species Human (GRCh38)
Location 5:137233772-137233794
Sequence TCTCACTTACTGATTCTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997840312_997840315 -7 Left 997840312 5:137233756-137233778 CCTGTGACTTTGCCGATCTCACT 0: 1
1: 0
2: 2
3: 31
4: 221
Right 997840315 5:137233772-137233794 TCTCACTTACTGATTCTAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997840315 Original CRISPR TCTCACTTACTGATTCTAGG AGG Intronic
901080738 1:6582438-6582460 TCTCACTTCCTGATTATCAGAGG - Intronic
902971617 1:20056724-20056746 ACTCCCTAACTCATTCTAGGAGG - Intronic
904360549 1:29968580-29968602 TCTCACTTAGTGACTCTAGAAGG - Intergenic
905375288 1:37516006-37516028 ACTCCCTTACTAATTTTAGGGGG + Intergenic
905455037 1:38082896-38082918 TCTAACTAACTGATTCAAGCTGG - Intergenic
905964182 1:42076872-42076894 TCTCCCTGACTCATTCTATGAGG - Intergenic
907901068 1:58741843-58741865 TCTGATTTACTTGTTCTAGGAGG - Intergenic
908411193 1:63867468-63867490 TCTCATACACAGATTCTAGGGGG - Intronic
908668223 1:66515962-66515984 TCTCCCCAACTGATTCTATGAGG + Intergenic
909485404 1:76167499-76167521 CCTCCCTTACTCATTCTATGAGG - Intronic
910058696 1:83062750-83062772 TCTGAGTTAATGATTATAGGGGG + Intergenic
910579364 1:88805721-88805743 TCTTACGTACTGATTATAGCAGG + Intronic
911083134 1:93952837-93952859 TCTCTCTAACTCATTCTAGGAGG - Intergenic
913084307 1:115422102-115422124 TCACATTTACTGGCTCTAGGAGG + Intergenic
914963801 1:152233553-152233575 TCTCTCTAACTCATTCTATGAGG - Intergenic
916593571 1:166218680-166218702 TCTCCCTAACTCATTCTATGAGG - Intergenic
916807818 1:168276841-168276863 TCTCCCTAACTCATTCTATGAGG - Intergenic
918100875 1:181373146-181373168 CCTCCCTAACTGATTCTATGAGG - Intergenic
918242255 1:182630880-182630902 TCTCACTCACTGGCTGTAGGTGG - Intergenic
918759169 1:188378870-188378892 TCTCTTTCACTGATTCTTGGTGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922632220 1:227127041-227127063 ACTCACTTATTAGTTCTAGGAGG - Intronic
923278065 1:232415712-232415734 TCTGACTGACTGACTCTGGGAGG - Intronic
923278081 1:232415789-232415811 TCTGACTGACTGACTCTGGGAGG - Intronic
923278102 1:232415901-232415923 TCTGACTGACTGACTCTGGGAGG - Intronic
923278110 1:232415941-232415963 TCTGACTGACTGACTCTGGGAGG - Intronic
923278124 1:232416017-232416039 TCTGACTGACTGACTCTGGGAGG - Intronic
923278131 1:232416057-232416079 TCTGACTGACTGACTCTGGGAGG - Intronic
923287995 1:232515248-232515270 TCTGACTGCATGATTCTAGGGGG + Exonic
924638512 1:245811071-245811093 TCACACTTACAAATTCCAGGAGG - Intronic
924927659 1:248698837-248698859 TCTCACTTACAGTTTCTTGCAGG + Intergenic
1065341344 10:24709400-24709422 TCTCCCTAACTCATTCTATGAGG + Intronic
1068950853 10:62775631-62775653 TCTCACTGACTGACTCTAAGAGG + Intergenic
1071245490 10:83757197-83757219 TCTCTCTAACTTATTCTATGAGG + Intergenic
1073705354 10:105977271-105977293 TCTCACTAACTTATTTTACGAGG - Intergenic
1076069562 10:127476599-127476621 CCTCACATACTGTTTCTCGGGGG + Intergenic
1078222358 11:9362484-9362506 TGTCAGTGACAGATTCTAGGTGG - Intergenic
1078297319 11:10086355-10086377 TAACTCTTACTGATTCTAAGTGG + Intronic
1078586443 11:12594775-12594797 TCTCATTTATTAATTCTAGTAGG - Intergenic
1080270233 11:30443468-30443490 TATCACTTTCTCATTGTAGGAGG + Intronic
1088670731 11:112137884-112137906 TCTCTCTTCCTGAATTTAGGTGG + Intronic
1089945336 11:122465526-122465548 TCTCACTAACTTATTCTATGAGG + Intergenic
1090179893 11:124687433-124687455 TCTCCCTAACTCATTCTATGAGG + Intronic
1090685335 11:129111409-129111431 TCTCCCTAACTCATTCTATGAGG - Intronic
1091811340 12:3400641-3400663 CCTCGCTAACTCATTCTAGGAGG + Intronic
1092146060 12:6215443-6215465 TTTCACTGAGTGAGTCTAGGAGG + Intronic
1092485252 12:8897336-8897358 TCTAACTTTCTAGTTCTAGGAGG + Intergenic
1092569424 12:9706861-9706883 TCTCCCTAACTCATTCTATGAGG - Intergenic
1093867086 12:24240602-24240624 TCTTTCTTACTGATTTGAGGAGG - Intergenic
1095183546 12:39174891-39174913 TCTCACTTAAGGATTGTAGATGG - Intergenic
1096298366 12:50403762-50403784 TCTATCCTACTGATTCTAGTGGG - Intronic
1096735748 12:53652666-53652688 ACTCACTTATTAATTCTAGTGGG + Intronic
1097304144 12:58051011-58051033 TCTCCCTAACTCATTCTATGAGG + Intergenic
1097554525 12:61120719-61120741 TCTCCCTAACTCATTCTATGAGG - Intergenic
1098484398 12:71004092-71004114 TCTCAGTCACTTCTTCTAGGAGG - Intergenic
1100025102 12:90118672-90118694 TCTCCCTAACTCATTCTATGAGG - Intergenic
1100197088 12:92258922-92258944 ACTCACTTATTGATTCTAGTGGG + Intergenic
1100749017 12:97676567-97676589 TCTCCCTAACTCATTTTAGGAGG + Intergenic
1100942176 12:99735743-99735765 TCTCCCTAACTCATTCTATGAGG + Intronic
1102054119 12:109883393-109883415 TCTCACTTCCTGATTCTACCTGG - Intergenic
1105396371 13:20040096-20040118 TCTCCCTAACTCATTCTATGAGG - Intronic
1107084717 13:36414065-36414087 CCTCCCTAACTCATTCTAGGAGG + Intergenic
1107223704 13:38019748-38019770 TCTCCCTAACTTATTCTAAGAGG - Intergenic
1108160933 13:47638445-47638467 TCTTCCTTACTCATTCTATGAGG + Intergenic
1109916919 13:69001306-69001328 TCTCCCTAACTCATTCTATGAGG + Intergenic
1110122961 13:71906075-71906097 TCTCTCTCTCTGATTCTAGATGG + Intergenic
1111234732 13:85394231-85394253 TCTCCCTTTCTCAGTCTAGGAGG + Intergenic
1111455392 13:88476424-88476446 TCACACTTTCTCATTCTAGAAGG + Intergenic
1112060263 13:95732186-95732208 TCTCCCTAACTCATTCTATGAGG - Intronic
1112076452 13:95918853-95918875 CCTCCCTTACTCATTCTATGAGG + Intronic
1114062649 14:19033648-19033670 TCACACTTTGTGATTCTAAGGGG + Intergenic
1114099612 14:19366349-19366371 TCACACTTTGTGATTCTAAGGGG - Intergenic
1115174236 14:30544252-30544274 TCTCCCTTAAAGCTTCTAGGAGG + Intergenic
1115639130 14:35320927-35320949 TCTCATCCACTGATTCTAGGAGG - Intergenic
1116348656 14:43829984-43830006 TCTCCCTAACTTATTCTATGAGG - Intergenic
1116659248 14:47687484-47687506 TCTCTTTAACTCATTCTAGGAGG - Intergenic
1118654054 14:67928009-67928031 TCTCCCTAACTCATTCTATGAGG - Intronic
1120626574 14:86834177-86834199 TCTCCCTAACTTATTCTATGAGG + Intergenic
1123482470 15:20645304-20645326 TCTCAGGTAATGACTCTAGGAGG - Intergenic
1124385107 15:29201126-29201148 ACTCACTTATTAATTCTAAGAGG + Intronic
1126485214 15:49172440-49172462 AGCCACTTACTCATTCTAGGAGG + Intronic
1127024221 15:54784964-54784986 TCTCCCTAACTCATTCTATGAGG + Intergenic
1128481169 15:68040126-68040148 TCTCCCTAACTCATTCTATGAGG + Intergenic
1129566583 15:76629767-76629789 TCTCCCTAACTCATTCTATGAGG - Intronic
1131658610 15:94488919-94488941 TCTCCCTAACTCATTCTATGAGG + Intergenic
1133147776 16:3802874-3802896 TATCGTTTTCTGATTCTAGGTGG - Intronic
1136573581 16:31110522-31110544 TCTCACTTAATGTTCCCAGGTGG - Intronic
1137310901 16:47257255-47257277 ACTCACTAACTGGTTCTAGGAGG - Intronic
1137527990 16:49253687-49253709 TCTTAGTATCTGATTCTAGGTGG - Intergenic
1137836705 16:51598884-51598906 TCTCACTGTGTGATTCTAGAAGG + Intergenic
1139107018 16:63838715-63838737 CCTCCCTTACCGATTCTATGAGG + Intergenic
1139330801 16:66188428-66188450 TCTAATTTCCTGATTTTAGGAGG - Intergenic
1139401913 16:66689011-66689033 ACTCACTTATTAGTTCTAGGAGG + Intronic
1141906624 16:87030975-87030997 TCTGACTTAATGAATCTGGGGGG + Intergenic
1144275276 17:13661370-13661392 TCTCATTTATTGCTTGTAGGAGG - Intergenic
1145258557 17:21341336-21341358 TCTCACTTACTGAGTCCATCAGG - Intergenic
1145318069 17:21746669-21746691 TCTCACTTACTGAATCCATCAGG + Intergenic
1145852598 17:28115949-28115971 TATTAATTACTGAATCTAGGTGG - Intronic
1146557561 17:33839647-33839669 TCTCAGTTAATTATTCTAGCTGG + Intronic
1147035183 17:37674657-37674679 TCTCACTTGCAAATTCTAAGGGG - Intergenic
1147814850 17:43201852-43201874 TCTCTCTTCGTGATTCTTGGTGG + Intronic
1149405181 17:56341814-56341836 TTTCCCTAACTGATTCTATGAGG - Intronic
1150154484 17:62840528-62840550 TCTCACTTATTGGTTCCATGAGG - Intergenic
1153115765 18:1653506-1653528 TCTCAGTTACTGGTTTTTGGTGG + Intergenic
1153603219 18:6803587-6803609 ACTCACTAACTCATTCTATGAGG - Intronic
1153771050 18:8416671-8416693 CCTCACTTCCTGCTTCCAGGGGG + Intergenic
1156433621 18:37101989-37102011 TCTCCCTAACTCATTCTATGAGG + Intronic
1156519934 18:37713659-37713681 TTTCACTGGCTGATTCTAAGGGG - Intergenic
1157821245 18:50771847-50771869 TCTCCCTAACTAATTCTATGAGG + Intergenic
1159350120 18:67261249-67261271 TGTCACCTACTGTTTCTAGAGGG - Intergenic
1162615320 19:11795789-11795811 TCTCCCTAACTCATTCTATGAGG - Intergenic
1163410987 19:17154403-17154425 GCACACTTACTGCTTCTTGGTGG - Exonic
1164139943 19:22450558-22450580 CCTTATTTACAGATTCTAGGTGG - Intronic
1164210343 19:23092939-23092961 TCTCCCTAACTCATTCTATGAGG - Intronic
1164845554 19:31429640-31429662 TCTCAGTTTCTCAGTCTAGGAGG - Intergenic
1166176612 19:41077023-41077045 TCTCCCTAACTGATTCTACGAGG - Intergenic
1168059047 19:53881120-53881142 TCTCTCTCTCTGATGCTAGGGGG - Intronic
926869879 2:17403654-17403676 TCTCTCTAACTTATTCTATGAGG + Intergenic
930234740 2:48877717-48877739 TCTCTCTTACTGAGGCTGGGTGG - Intergenic
930458841 2:51643191-51643213 TCTCAATTACAGATGCTAGAAGG - Intergenic
930555568 2:52891458-52891480 CCTCACTAACTCATTCTATGAGG - Intergenic
933365567 2:81349258-81349280 TCTCCCTAACTCATTCTATGAGG + Intergenic
936149364 2:110005200-110005222 CCTCACTAACTCATTCTATGAGG - Intergenic
936195316 2:110366175-110366197 CCTCACTAACTCATTCTATGAGG + Intergenic
937777136 2:125791605-125791627 TAGCACTTACTTATTCAAGGTGG + Intergenic
938019490 2:127894340-127894362 ACTCACTTATTAGTTCTAGGAGG + Intergenic
938090554 2:128429657-128429679 ACTCACTTGTTAATTCTAGGAGG + Intergenic
938480016 2:131653855-131653877 TCACACTTTGTGATTCTAAGGGG + Intergenic
941674869 2:168333151-168333173 TCTCCCTAACTTATTCTATGAGG + Intergenic
942375916 2:175337539-175337561 TCTCCCTAACTCATTCTATGAGG - Intergenic
943060755 2:183038933-183038955 TCTCACAAACTGGTTCCAGGCGG - Intergenic
944604463 2:201338922-201338944 TCTCCCTTACTTATTCTGTGAGG - Intronic
944693085 2:202175603-202175625 TCTCACTTTCTGGTTCATGGAGG - Intronic
946064582 2:216975592-216975614 TCACAGTTACAGGTTCTAGGTGG + Intergenic
946547830 2:220764961-220764983 TCTCACTTAATGATTGAATGGGG + Intergenic
946810330 2:223517237-223517259 TTTCACTTACTTATTCTAAATGG + Intergenic
1169412730 20:5386498-5386520 TCTCTCTAACTCATTCTATGAGG + Intergenic
1170726993 20:18938363-18938385 TCTCTCTTACTCATTTTATGAGG - Intergenic
1170766717 20:19295866-19295888 TCTCTCTAACTCATTCTATGAGG - Intronic
1171338015 20:24404722-24404744 ACTCACTTATTGGTTCTAGTTGG + Intergenic
1174119846 20:48256384-48256406 ACTCACTAAATTATTCTAGGAGG - Intergenic
1175209909 20:57347426-57347448 TCTCCCTTTTTGTTTCTAGGAGG + Intergenic
1178115414 21:29411820-29411842 TCTCACGTACAGATTATGGGGGG - Intronic
1178808374 21:35858671-35858693 CCTCACTGACTGATTTGAGGAGG - Intronic
1178851875 21:36219309-36219331 TGTCACTTACTGATTTAAAGGGG + Intronic
1180481141 22:15756275-15756297 TCACACTTTGTGATTCTAAGGGG + Intergenic
1180583400 22:16863171-16863193 CCTCACTAACTCATTCTATGAGG + Intergenic
1180944794 22:19686425-19686447 ACTCACTTATTAGTTCTAGGAGG - Intergenic
1182115576 22:27754486-27754508 GCTCTCTTTCTCATTCTAGGCGG - Intronic
1182203368 22:28597099-28597121 TATCATTTGCTCATTCTAGGTGG + Intronic
950130145 3:10537555-10537577 ACTCACTTATTACTTCTAGGAGG + Intronic
950293013 3:11802679-11802701 TCTCCCTAACTCATTCTATGAGG + Intronic
951335988 3:21422474-21422496 TCTCCCTAACTCATTCTATGAGG + Intronic
951921222 3:27856417-27856439 TCTCCCTAACTCATTCTATGAGG + Intergenic
951930735 3:27964253-27964275 TCTCAGTTTCTGATTCTAAAAGG + Intergenic
952940021 3:38436551-38436573 TCTCCCTAACTCATTCTATGAGG + Intergenic
955170049 3:56554882-56554904 ACTCACTTATTAATTCCAGGAGG + Intergenic
955997328 3:64690434-64690456 TCTCACTTACTGGATTGAGGGGG - Intergenic
957811299 3:85226126-85226148 TCTCCCTAACTGATTTTAAGAGG - Intronic
958082495 3:88764429-88764451 TCTCCCTAACTCATTCTATGAGG - Intergenic
958910919 3:99993978-99994000 TCTCCCTAACTTATTCTATGAGG - Intronic
959160706 3:102721201-102721223 TCTCATTCTCTGAATCTAGGAGG - Intergenic
959607234 3:108255156-108255178 TCTCACCTACTTATTCAAGAAGG - Intergenic
960118598 3:113923787-113923809 TCTCCCTAACTCATTCTATGAGG - Intronic
960367969 3:116796612-116796634 TCTCACTGACTGAGCCTAGCAGG + Intronic
961938747 3:130614518-130614540 TCTCCCTAACTCATTCTACGAGG - Intronic
962554424 3:136532385-136532407 TCTCAGTAACTCATTCTAGAAGG - Intronic
962994179 3:140608864-140608886 CCTCCCTAACTCATTCTAGGAGG + Intergenic
963653672 3:148017850-148017872 TCTCCCTAACTCATTCTATGAGG + Intergenic
964015297 3:151938133-151938155 TCTCACTTGCTGATTTTCTGTGG - Intergenic
964061789 3:152533607-152533629 CCTCCCTTACTCATTCTATGAGG - Intergenic
965230623 3:166047323-166047345 TCTCCCTAACTCATTCTATGAGG - Intergenic
965283169 3:166780485-166780507 CCTCCCTGACTCATTCTAGGAGG - Intergenic
965631315 3:170735559-170735581 TCTCCCTAACTCATTCTATGAGG + Intronic
966503661 3:180674989-180675011 TCTCCCTAACTCATTCTATGAGG - Intronic
968470396 4:779282-779304 ACTCACTTACTGGCTCTACGAGG + Intergenic
970783656 4:19769944-19769966 TCTGACTTAGTGACTCAAGGTGG + Intergenic
970878622 4:20902107-20902129 TCTCATATTCTGATTCTAAGAGG + Intronic
971784733 4:31085305-31085327 TCTCAAGCACTGATCCTAGGAGG + Intronic
973140008 4:46754924-46754946 TCTCCCTAACTCATTCTATGAGG + Intronic
974339752 4:60600371-60600393 TCTCACTAACTCATTTTATGAGG - Intergenic
975400114 4:73927370-73927392 TCTCTCTAACTCATTCTATGAGG + Intergenic
975885349 4:78958445-78958467 TCACAGTCACAGATTCTAGGTGG - Intergenic
976335994 4:83887382-83887404 TCTTACCTACTTATTATAGGTGG - Intergenic
976385135 4:84448229-84448251 TCTCACTTATTCCTTCTAGTGGG - Intergenic
977124099 4:93142336-93142358 TCTCATTTATGGATGCTAGGAGG + Intronic
977203546 4:94144976-94144998 CCTCACTAACTGATTTTATGAGG - Intergenic
977652052 4:99481804-99481826 CCTCACTAACTCATTCTATGAGG - Intergenic
982879277 4:160690614-160690636 CCTCACTAACTAATTCTATGAGG + Intergenic
983134606 4:164065159-164065181 TCTCCCTAACTCATTCTATGAGG - Intronic
983282567 4:165699468-165699490 CCTGACTTACTGACTCTAGCTGG + Intergenic
985581500 5:697817-697839 TCTCTCTAACTCATTCTATGAGG + Intergenic
985596127 5:789145-789167 TCTCTCTAACTCATTCTATGAGG + Intergenic
987106334 5:14643453-14643475 TCTCCCTAACTCATTCTATGAGG - Intergenic
987260750 5:16200047-16200069 TCTCCCTAACTCATTCTATGAGG + Intergenic
989693634 5:44173646-44173668 CCTCCCTAACTCATTCTAGGAGG + Intergenic
989733966 5:44680206-44680228 CCTCACTAACTTATTCTATGAGG + Intergenic
989785383 5:45321284-45321306 TCTCACTTATTTATTCCTGGGGG + Intronic
990054556 5:51555690-51555712 ACTCACTTATTAATTCTACGAGG - Intergenic
990898034 5:60720186-60720208 TCTCCCTAACTCATTCTATGAGG + Intergenic
991174494 5:63670896-63670918 CCTCCCTAACTGATTCTATGAGG + Intergenic
992355664 5:75980346-75980368 CCTCCCTAACTGATTCTATGAGG + Intergenic
993751846 5:91679106-91679128 CCTCCCTAACTTATTCTAGGAGG - Intergenic
994771961 5:103993154-103993176 TCTCACTTCCTGCCTCCAGGAGG - Intergenic
996953880 5:129160526-129160548 CCTCCCTTACTCATTCTATGAGG - Intergenic
997840315 5:137233772-137233794 TCTCACTTACTGATTCTAGGAGG + Intronic
998275576 5:140749930-140749952 TCTCCCTAACTCATTCTAAGAGG - Intergenic
998881350 5:146648286-146648308 TCTGAATTACTGATTGGAGGAGG + Intronic
999863999 5:155680375-155680397 TCTTCCTAACTCATTCTAGGAGG - Intergenic
1001089946 5:168731435-168731457 TCTCCCTTACTCATTCTATGAGG + Intronic
1001687851 5:173608514-173608536 CCTCACTTACTGATTATAACAGG + Intronic
1002976047 6:2077790-2077812 TCTCCCTAACTCATTCTATGAGG - Intronic
1003608233 6:7585017-7585039 TCTTACTTACTGATTCATGTCGG - Exonic
1004825940 6:19421383-19421405 TCTCCCTAACTCATTCTATGAGG - Intergenic
1007220961 6:40278382-40278404 TCCCTCTTACTAATTCTATGGGG + Intergenic
1007586540 6:42993826-42993848 TCACATTCACAGATTCTAGGTGG + Intronic
1008183170 6:48358782-48358804 CCTCCCTAACTCATTCTAGGAGG + Intergenic
1009514293 6:64594932-64594954 TCTTCCTTACTCATTCTATGAGG + Intronic
1010496186 6:76536066-76536088 TCTCCCTAACTCATTTTAGGAGG - Intergenic
1011316122 6:86033302-86033324 TCTCACTAACTCATTTTATGAGG + Intergenic
1012292434 6:97473864-97473886 TCTCACTATCTCATACTAGGTGG - Intergenic
1014040977 6:116824724-116824746 TCTCTCTAACTCATTCTATGAGG + Intronic
1014341054 6:120207377-120207399 CCTCACTAACTCATTCTATGAGG + Intergenic
1015311614 6:131773077-131773099 TCTCAAGCACTGATTTTAGGAGG + Intergenic
1016259044 6:142145841-142145863 TCTCACTTAATTGTTCTAGGTGG - Intergenic
1016545367 6:145216956-145216978 TCTCTCTTACTGATTAAAGATGG - Intergenic
1016697834 6:147018265-147018287 TCACATTTACAGATACTAGGGGG + Intergenic
1019228782 6:170539042-170539064 TCTCTCTTGCTTCTTCTAGGGGG - Intronic
1020375888 7:7486311-7486333 ACTCACTTGTTAATTCTAGGAGG + Intronic
1020702646 7:11502269-11502291 TCTCCCTAACTCATTCTATGAGG + Intronic
1022935141 7:35167397-35167419 TCTCCCTTACTCATTCTATAAGG + Intergenic
1023211656 7:37812049-37812071 CCTCCCTTACTCATTCTATGAGG + Intronic
1024122203 7:46255690-46255712 ACTCACTTATTAATTCTAGTAGG - Intergenic
1027860186 7:83568357-83568379 TCTCCCTAACTCATTCTAAGAGG + Intronic
1028008996 7:85616211-85616233 CCTCACTAACTCATTCTATGAGG + Intergenic
1028432142 7:90759707-90759729 TCTTTCCTACTGAATCTAGGGGG + Intronic
1031103483 7:117511243-117511265 TCTCACTTACTTATACCTGGGGG + Intronic
1032779638 7:135153849-135153871 TCTCCCTAACTGATTCTCCGAGG - Intronic
1032901502 7:136314775-136314797 TCTCCCTAACTTATTCTATGAGG - Intergenic
1033676966 7:143551811-143551833 TCTCCCTAACTTACTCTAGGAGG - Intergenic
1033694869 7:143777626-143777648 TCTCCCTAACTTACTCTAGGAGG + Intergenic
1033850756 7:145491706-145491728 CCTCCCTAACTCATTCTAGGAGG + Intergenic
1035645885 8:1219624-1219646 TCTCCCTAACTCATTCTATGAGG - Intergenic
1036465544 8:8993649-8993671 TCTTAATTACTGATTTTGGGGGG - Intergenic
1037852342 8:22341909-22341931 TCTCACTTACTAGTTCTAGCAGG - Intronic
1038329048 8:26593305-26593327 TCTGACTTAATTGTTCTAGGTGG + Intronic
1039113820 8:34070137-34070159 TGTCACTTACTGAGTCAAGTTGG + Intergenic
1040944367 8:52867920-52867942 CCTCACTTATTTCTTCTAGGAGG + Intergenic
1042381773 8:68123897-68123919 CCTCCCTAACTTATTCTAGGAGG + Intronic
1042473437 8:69217641-69217663 CCTCACTAACTCATTCTATGAGG + Intergenic
1044450619 8:92332028-92332050 CCTCCCTAACTGATTCTATGAGG - Intergenic
1044675179 8:94720822-94720844 TCTCACTTCCTGAAACTAGTAGG - Intronic
1045100664 8:98840751-98840773 TCTGACTTACAGAGACTAGGAGG - Intronic
1046453080 8:114419425-114419447 TCTCCCTAACTCATTCTATGAGG + Intergenic
1047434141 8:124821340-124821362 ATTCACTTATTAATTCTAGGAGG + Intergenic
1047475668 8:125226602-125226624 TCTCACTTTCTGACTCCTGGAGG + Intronic
1047574236 8:126135341-126135363 TCACATTCACAGATTCTAGGTGG + Intergenic
1047957312 8:129985532-129985554 TCTCATTTACTATTTCTGGGGGG - Intronic
1050408320 9:5333651-5333673 TCTCCCTAACTCATTCTATGAGG + Intergenic
1050606812 9:7310235-7310257 TCTCCCTAACTCATTCTATGAGG - Intergenic
1050675661 9:8049942-8049964 TCTCTCTAACTCATTCTATGAGG - Intergenic
1050983525 9:12052144-12052166 TCACATTTACTGATTTTAGTAGG + Intergenic
1052078871 9:24178831-24178853 TCTCCCTAACTTATTCTATGAGG - Intergenic
1054900607 9:70365031-70365053 ACTCACTTATTGGTTCTAGTAGG - Intergenic
1055832444 9:80397399-80397421 GCTCAGTTCCTGATTTTAGGAGG + Intergenic
1056134612 9:83619928-83619950 TCTCACTTATTAACTCTAGTAGG + Intergenic
1057932536 9:99207515-99207537 TCTCCCTAACTCATTCTATGAGG - Intergenic
1058517610 9:105792791-105792813 CCTCCCTTACTCATTCTATGAGG - Intergenic
1061476950 9:130874236-130874258 TCTCACTTCCTGATTCTCCCAGG - Intronic
1061698581 9:132397275-132397297 TCTCACTTTCTCACTCTAAGGGG + Intronic
1062241548 9:135543141-135543163 ACTCACTTACTAGTTCTAGGAGG + Intergenic
1186137739 X:6536873-6536895 TCTCAATTATTGATTTTAGTTGG - Intergenic
1187640340 X:21281240-21281262 CCTCACTAACTCATTCTATGAGG - Intergenic
1188744504 X:33826262-33826284 TCTCTCTAACTCATTCTATGAGG - Intergenic
1189564307 X:42224648-42224670 TCTCTCTTACTAATTCTATGAGG - Intergenic
1191093634 X:56651567-56651589 TCTCCCTAACTCATTCTATGAGG - Intergenic
1191099330 X:56708233-56708255 TCTCCCTAACTCATTCTATGAGG - Intergenic
1191611978 X:63126158-63126180 TCTCACTAACTCATTCTATGAGG + Intergenic
1192724782 X:73737695-73737717 TCTCCCTTACTCATTCTACAAGG - Intergenic
1192949469 X:76001600-76001622 TCTCCCTAACTCATTCTATGAGG - Intergenic
1193032378 X:76912800-76912822 TCTCCCTAACTCATTCTATGAGG + Intergenic
1193044817 X:77041179-77041201 CCTCCCTTACTCATTCTATGAGG + Intergenic
1193301973 X:79899962-79899984 TCTCCCTAACTGAATCTATGAGG + Intergenic
1193944206 X:87711967-87711989 TCTCCCTAACTCATTCTATGAGG + Intergenic
1193970371 X:88043412-88043434 TCTCCCTGACTCATTCTATGAGG + Intergenic
1194525696 X:94974766-94974788 TCTCTCTAACTCATTCTATGAGG - Intergenic
1194540230 X:95160821-95160843 TCTCCCTAACTCATTCTACGAGG + Intergenic
1195466089 X:105180840-105180862 TCTCCCTAACTCATTCTATGAGG - Intronic
1196484249 X:116186367-116186389 TTTCTCTAACTGATTCTATGAGG + Intergenic
1196622122 X:117835687-117835709 ACTCAGATACAGATTCTAGGAGG - Intergenic
1197243685 X:124146603-124146625 TCTCCCTAACTCATTCTATGAGG - Intronic
1198192813 X:134327041-134327063 TCTCCCTAACTAATTCTATGAGG - Intergenic
1198298897 X:135314681-135314703 TCTCTCTTCCTGATTCAAGCTGG + Intronic
1199109625 X:143915267-143915289 TCTTACTTACTTATTCTATAAGG - Intergenic
1199755402 X:150859961-150859983 TCTCCCTAACTTATTCTATGAGG + Intronic
1200086778 X:153610983-153611005 TCCCACTCACTGAGGCTAGGAGG - Intergenic
1200571109 Y:4830693-4830715 CCTCACTAACTCATTCTATGAGG + Intergenic
1200879429 Y:8197080-8197102 TCTCCCTAACTCATTTTAGGAGG + Intergenic
1201439080 Y:13988686-13988708 TCTCAATTATTGATTTTAGTTGG - Intergenic
1201445493 Y:14054022-14054044 TCTCAATTATTGATTTTAGTTGG + Intergenic