ID: 997841575

View in Genome Browser
Species Human (GRCh38)
Location 5:137245673-137245695
Sequence CTCAAGTCTCAAGGGATGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997841575 Original CRISPR CTCAAGTCTCAAGGGATGTA CGG Intronic
900492131 1:2955647-2955669 CCCAGGTTTCAAAGGATGTATGG - Intergenic
901830638 1:11890035-11890057 CTCAAGGTTTAAGGGATTTAGGG + Intergenic
903947359 1:26972174-26972196 CCCAAGTCTACAGGGATGAAGGG + Intergenic
904837374 1:33348201-33348223 TTTAGGTCACAAGGGATGTAGGG - Intronic
905964758 1:42082244-42082266 CTTGAGTCTCAGAGGATGTATGG + Intergenic
907335409 1:53696344-53696366 CTCAAGTTTTAAGGAATCTAAGG + Intronic
909598888 1:77440508-77440530 CCCAAGTCTGAGGGGATATATGG - Intronic
912138337 1:106689526-106689548 TTCAAGGCTCAAGAGATGCAGGG + Intergenic
912642463 1:111360498-111360520 CTCAAGTTTTAATGGATTTAGGG - Intergenic
918589595 1:186225523-186225545 CACAAGGCACAAGGCATGTAAGG + Intergenic
919646631 1:200101517-200101539 CACAACTCTTAAGGGAAGTATGG + Intronic
920646615 1:207808359-207808381 CTCACCTAGCAAGGGATGTACGG + Intergenic
923459386 1:234195442-234195464 ATCAAGGCTCAAGGCATGTGGGG + Intronic
1062863190 10:826399-826421 CCCAAGTCACAAGGTAAGTATGG + Intronic
1063808320 10:9673994-9674016 CTCCAGTCTAATGGTATGTAAGG + Intergenic
1064494436 10:15894383-15894405 CTCAAGTCTCAAGTCCTGCAGGG - Intergenic
1068002997 10:51358410-51358432 CTCAAGTGTCAAGGAATGACAGG + Intronic
1070078787 10:73165298-73165320 TTCAAGTCTCATGGGATGGTAGG + Intronic
1070998283 10:80806079-80806101 ATCAAGGTTTAAGGGATGTAGGG + Intergenic
1071934198 10:90508729-90508751 CTCAAGCAGCAAGGGATGCAGGG + Intergenic
1074289308 10:112126549-112126571 CTCAGCTCTCCAGGGAGGTAGGG - Intergenic
1075423914 10:122327186-122327208 CTGAAATCTCAAAGGATCTAAGG - Intronic
1077597352 11:3545550-3545572 ATCAAGGTTTAAGGGATGTAGGG + Intergenic
1079130849 11:17746167-17746189 CTCCAGGCTCAGGGGATGGAGGG - Intronic
1081121534 11:39272341-39272363 ATCACGTCTCAGGGGTTGTATGG + Intergenic
1082288872 11:50346624-50346646 ATCAAGGTTTAAGGGATGTAGGG + Intergenic
1084253454 11:67921458-67921480 ATCAAGGTTTAAGGGATGTAGGG + Intergenic
1084819424 11:71674468-71674490 ATCAAGGTTTAAGGGATGTAGGG - Intergenic
1086730500 11:90242873-90242895 CTCACGTCTCATGGATTGTAAGG + Intergenic
1088828131 11:113513033-113513055 CTAAGGTCACAAGGGATGTGGGG + Intergenic
1092183057 12:6459121-6459143 ATGAAGTCTCAGGGGATGTGTGG - Intronic
1098051643 12:66460296-66460318 CTGCAGTCTCAAGAGATATATGG + Intronic
1098217926 12:68239388-68239410 CTGAAGACACAAGGGATGCAAGG - Intergenic
1100820155 12:98422608-98422630 CTCAAGTCTCTAGCTATGTCCGG - Intergenic
1104019034 12:124979687-124979709 CTGAAGTCCCAAGGGATGGCAGG + Intronic
1107375684 13:39801556-39801578 CTTAAATCACAAGGGATGCAAGG + Intergenic
1108137849 13:47385163-47385185 CTCAAGTCCTAACAGATGTATGG - Intergenic
1110588257 13:77221289-77221311 CCCAAGTCTGAAGAGATATAGGG - Intronic
1112682626 13:101784548-101784570 CTAAAGTCTAAAGGGAAGAAAGG - Intronic
1113640462 13:111953542-111953564 CTCAATGCTCAAGGCATGGATGG - Intergenic
1114479145 14:23020857-23020879 CTCAAGACTCAAGGGAGACATGG + Intronic
1117473489 14:56070407-56070429 TTGAAATCTCAAGTGATGTATGG - Intergenic
1120641596 14:87020307-87020329 CTCAAGGCTTAATGGATTTAGGG + Intergenic
1121570376 14:94942563-94942585 CTGAAGTCTCAAGGGGCGAAAGG - Intergenic
1125553394 15:40564854-40564876 CTCAGGTCTCTAGGGCTGTCTGG + Exonic
1127814898 15:62599235-62599257 GTCAAGTCTAAAGGGATAGAGGG + Intronic
1128566718 15:68705643-68705665 TTCAAGTCTCATGGAATGAAGGG - Intronic
1129472207 15:75762177-75762199 CTCAAGGCTCAAGGCATCAAAGG - Intergenic
1130991068 15:88876298-88876320 CTCAACTCTCAAGGTTTGTCAGG - Intergenic
1131274964 15:90973267-90973289 ATCAAGGTTCAAGGGATCTAGGG + Intronic
1132831624 16:1931027-1931049 ATCAAGGTTTAAGGGATGTAGGG + Intergenic
1133382962 16:5346435-5346457 ACCACGTCTCAAGGGATGCATGG + Intergenic
1137929610 16:52574447-52574469 CTGAAGTCTCAAATGATCTAGGG + Intergenic
1139114841 16:63937564-63937586 CTAAAGTGTCAAGGAATGAAAGG - Intergenic
1145033052 17:19519880-19519902 CTCAAGGTTTAAGGGATTTAGGG + Intronic
1146798940 17:35803541-35803563 CCCAAGACTCAAGAGATGGAGGG + Intronic
1146828127 17:36041653-36041675 CCCAAGACTCAAGAGATGGAGGG - Intergenic
1149585285 17:57782363-57782385 CTCAAGTCGCATGGGAAGGAGGG - Intergenic
1150282280 17:63935660-63935682 TTCAAGGCTCAAAGGATGTGTGG + Intergenic
1154234409 18:12590613-12590635 CTCAGGGCTCAGGGGTTGTAAGG - Intronic
1155581539 18:27313800-27313822 CTCAACCCTCGAGGGAAGTAGGG - Intergenic
1157389426 18:47288792-47288814 CTCAAGTCTGAAAGGATGTGAGG - Intergenic
1159336758 18:67077561-67077583 CTCAAGGCTTAATGGATTTAGGG - Intergenic
1159477587 18:68943046-68943068 CTCAAGGCTTAATGGATTTAGGG - Intronic
1159794214 18:72822228-72822250 CTCAAGTCTCAGAGGGTGGAGGG + Intronic
1160557024 18:79732211-79732233 CTCAAGTCTCATGTGATTTTGGG - Intronic
1160557029 18:79732300-79732322 CTCATGTCTCAAGTGATTTTGGG - Intronic
1160557056 18:79732677-79732699 CTCAAGTCTCAAGTGATTTTGGG - Intronic
1165523564 19:36332949-36332971 CTCAAGGTTCAATGGATTTAGGG - Intergenic
1166635444 19:44447519-44447541 CTCTAGTGTCAAGAGATGTGGGG + Exonic
1167336954 19:48892400-48892422 CTCAAGTTTTAAGGGATTTAGGG - Intronic
925476128 2:4217323-4217345 ATAAAGTCTGAAGGGTTGTAGGG - Intergenic
930207703 2:48604326-48604348 CTTGAGTCTTAAGGGATGTCAGG - Intronic
931691868 2:64840576-64840598 CTCATGCCACAAGGGATCTAAGG - Intergenic
936103647 2:109605114-109605136 TTCAAGTCTCAAGGAATCAATGG - Intronic
938324828 2:130391378-130391400 CACAAGTCTCAGGGGCTGTGGGG - Intergenic
940135927 2:150435912-150435934 CTTAAGTTTCAGAGGATGTATGG + Intergenic
940382550 2:153032759-153032781 CTTGAGTCTCGGGGGATGTATGG - Intergenic
940531842 2:154887238-154887260 CTCAAGTGTCCTTGGATGTATGG + Intergenic
940931851 2:159441986-159442008 CTCAAGTCTCTGGGGATACAAGG + Intronic
941139594 2:161762988-161763010 CTCATAACTCAAGGAATGTATGG - Intronic
942192506 2:173483982-173484004 CTCAGGTCACAAGGGAGGTAAGG - Intergenic
942505843 2:176640705-176640727 CTCAAGTCTTCAGTGATGAAAGG + Intergenic
942557607 2:177187872-177187894 TCCAAGTCTCAAGTGATGAAAGG + Intergenic
944236485 2:197445846-197445868 CTCAAGGCTCAAGGTTTTTATGG - Intergenic
944427955 2:199603478-199603500 CTCAAGATTCAAGGGGTGAAGGG - Intergenic
947007455 2:225528664-225528686 CACAACTCTCTAGGGATTTAGGG - Intronic
1168875104 20:1166040-1166062 CACAAGGTTCAAGGGAAGTATGG - Exonic
1169594721 20:7185063-7185085 CTCCAGTCTCAAAGTATGTGTGG + Intergenic
1172337182 20:34127113-34127135 CTCAAGTTTTAAGGGATTTAGGG + Intergenic
1176655711 21:9587681-9587703 CCCAAGTGTCAATGGATGGATGG - Intergenic
1180513596 22:16118368-16118390 ATCAAGGCTTAAGGGATCTAGGG + Intergenic
1185160405 22:49224322-49224344 CCCAAGTCTCCATGGATGGATGG + Intergenic
950753084 3:15146329-15146351 ATCAAGGTTTAAGGGATGTAGGG - Intergenic
950968344 3:17162231-17162253 CTCAAGTCTAATGAGATATATGG + Intronic
951283101 3:20776861-20776883 CTCAAGTCTGAAGGGACAGAGGG + Intergenic
952093603 3:29921692-29921714 CTGAAGTCTCAAGGCATGGATGG - Intronic
955866214 3:63387445-63387467 CTCAAGTATCAAAAGAGGTAGGG - Intronic
957045990 3:75374972-75374994 ATCAAGTTTTAAGGGATCTAGGG - Intergenic
957067522 3:75537919-75537941 ATCAAGGTTTAAGGGATGTAGGG + Intergenic
959037793 3:101386446-101386468 CTTGAGTCTCAGGGGATGTGTGG - Intronic
959405523 3:105958201-105958223 CTCAAGTTTCAAGGGAGTTCAGG - Intergenic
960510223 3:118540648-118540670 CTCAAGGCTTAATGGATTTAGGG - Intergenic
960525104 3:118700935-118700957 CCCAAGTGTCAAGGAATGGAGGG - Intergenic
961285627 3:125800054-125800076 ATCAAGGTTTAAGGGATGTAGGG - Intergenic
963164796 3:142190401-142190423 CTCAATTCTCTATGGATCTAAGG - Intronic
963269966 3:143276874-143276896 CTCAGGTCTCTAGGGGTTTATGG - Intronic
969801359 4:9568118-9568140 ATCAAGGTTTAAGGGATGTAGGG - Intergenic
975519729 4:75287404-75287426 ATCAAGGCTTAAGGGATCTAGGG - Intergenic
975888235 4:78991790-78991812 CTCACTTCTCAAGGGAGGTGAGG - Intergenic
976563606 4:86529347-86529369 CTCAAGTCTGCAGGCATGTGAGG + Intronic
976784530 4:88802886-88802908 CTCCAGTCTCAAAGGAAGGAGGG - Intronic
978048893 4:104171166-104171188 ATCAAGGCTTAAGGGATCTAGGG + Intergenic
978063203 4:104364271-104364293 CTCAAGTTTCACAAGATGTATGG - Intergenic
979550824 4:121989015-121989037 GTCAAGTCTCAAGGGGTCTAAGG + Intergenic
984600148 4:181717069-181717091 ATCATGTGTTAAGGGATGTATGG + Intergenic
987066977 5:14299325-14299347 CTGAAGTCTCAGTGCATGTACGG + Intronic
987429216 5:17811476-17811498 CTCAAGTCACAAAGGATATTTGG + Intergenic
988062966 5:26197603-26197625 CTCAAGGTTTAAGGGATCTAGGG + Intergenic
993378522 5:87179022-87179044 ATAAATTCTCAAAGGATGTACGG + Intergenic
997841575 5:137245673-137245695 CTCAAGTCTCAAGGGATGTACGG + Intronic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
1001278844 5:170371320-170371342 CTGAAGTCTCAATAGATGTGGGG - Intronic
1001571095 5:172731235-172731257 CTCCAGTCTCAAGGGATTGTGGG + Intergenic
1012556906 6:100524686-100524708 CTCAAGTCTCTGTGGCTGTAGGG + Intronic
1012594237 6:101022387-101022409 CTTGAGTCTCAGGGGATGTGTGG - Intergenic
1013963551 6:115928773-115928795 CTCTAGTCTGAAGGTATGCATGG - Intergenic
1018416132 6:163603537-163603559 CTCTAGTTGGAAGGGATGTAGGG + Intergenic
1019355594 7:577216-577238 CTCAAGTCCCAGTGGATGTTTGG - Intronic
1022137334 7:27461254-27461276 CTCAAAACTCATGGGATGTGTGG - Intergenic
1022179831 7:27908417-27908439 CTCAAGTCTCATGGGTTTTGGGG + Intronic
1023209195 7:37784825-37784847 CTCATGTCTCAATGGAAGAAAGG + Intronic
1025574513 7:62619397-62619419 ATCAAGGTTTAAGGGATGTAGGG + Intergenic
1031580803 7:123472435-123472457 CTCAAATCTCATGGGATGGAAGG + Intronic
1036270584 8:7299447-7299469 ATCAAGGCTTAAGGGATCTAGGG - Intergenic
1036350765 8:8010897-8010919 ATCAAGGCTTAAGGGATCTAGGG + Intergenic
1037272131 8:17141830-17141852 CTCACGGCTCAAGTGATGTGAGG + Intergenic
1038349007 8:26759681-26759703 CTGAAGTCTCAAGGGATGGGAGG - Intronic
1039562862 8:38527046-38527068 CTCTGCTCTCCAGGGATGTAGGG + Intronic
1048608379 8:135994499-135994521 CACAAGTCCTAAGGCATGTAGGG + Intergenic
1051586815 9:18735396-18735418 CTCATGTGGCAAGGGATGAAGGG - Intronic
1052218321 9:25992589-25992611 CACAAGTCACCAGGGAAGTAGGG - Intergenic
1054537322 9:66245375-66245397 CTCAAGCCCCAGGGGATTTAGGG + Intergenic
1054897339 9:70328852-70328874 CTTAGGTTTCAAAGGATGTATGG - Intronic
1055360776 9:75488277-75488299 CTCAGGTCTCCAGGGAGGGAGGG + Intergenic
1059710219 9:116861022-116861044 TTCAAGGTTCAATGGATGTAAGG - Intronic
1203633428 Un_KI270750v1:91142-91164 CCCAAGTGTCAATGGATGGATGG - Intergenic
1188552141 X:31376085-31376107 CTAAAGTCTAAAGAGATGTGTGG - Intronic
1188959968 X:36479275-36479297 TTAAAGCCTCAAGGGATGGAAGG - Intergenic
1189208711 X:39264643-39264665 TTAAAGTCTCAAGGGATACAGGG + Intergenic
1192205929 X:69096097-69096119 CTCAAAGCTAAAGGGATGAAGGG + Intergenic
1192547632 X:72027105-72027127 CTGAAGTCTCAGGGTGTGTAGGG - Intergenic
1193195908 X:78631507-78631529 CCCAATTCTCAGAGGATGTATGG + Intergenic
1193390104 X:80915717-80915739 CTTAAGTCTCAAGAGAGATATGG + Intergenic
1195466443 X:105183911-105183933 CTTAGGTCTCAGGGGATGTCTGG + Intronic
1195965587 X:110427309-110427331 CTCAAGTCTCAGGTGTTGTGAGG - Intronic
1200416392 Y:2916075-2916097 CTCAAGTTTCAAAGCTTGTAGGG - Intronic
1201368752 Y:13237641-13237663 CTTAGGTCTCAAGGAATGTGAGG - Intergenic