ID: 997843648

View in Genome Browser
Species Human (GRCh38)
Location 5:137265697-137265719
Sequence AGTCCAGATAGAGCCTCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997843647_997843648 4 Left 997843647 5:137265670-137265692 CCACTCTAAGGCTGCTAAGATAT 0: 1
1: 0
2: 0
3: 1
4: 81
Right 997843648 5:137265697-137265719 AGTCCAGATAGAGCCTCCAAAGG No data
997843646_997843648 10 Left 997843646 5:137265664-137265686 CCGTTACCACTCTAAGGCTGCTA 0: 1
1: 0
2: 0
3: 9
4: 111
Right 997843648 5:137265697-137265719 AGTCCAGATAGAGCCTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997843648 Original CRISPR AGTCCAGATAGAGCCTCCAA AGG Intronic
No off target data available for this crispr