ID: 997846296

View in Genome Browser
Species Human (GRCh38)
Location 5:137289032-137289054
Sequence GTTGAAGCCAAGACTCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997846296 Original CRISPR GTTGAAGCCAAGACTCAAGC TGG (reversed) Intronic
903648075 1:24906588-24906610 GTTGCAGCCAGGCCTCAGGCAGG - Intronic
907469445 1:54663785-54663807 GTCGATTCCAGGACTCAAGCAGG - Intronic
907992252 1:59594440-59594462 GAAGAAGCCAAGATTCAAGAGGG + Intronic
908380180 1:63590615-63590637 TTTGAAGTCAAGAGCCAAGCTGG - Intronic
916624145 1:166535363-166535385 GCTGAAGGGAAGAGTCAAGCTGG - Intergenic
918186196 1:182129711-182129733 GCTGAAGCAAAGAGGCAAGCGGG + Intergenic
918586202 1:186191925-186191947 GTTAAAGTCAAGACTCTGGCTGG - Intergenic
924330551 1:242936650-242936672 GTTGACTCCAAGACTCCTGCTGG - Intergenic
1067697352 10:48545535-48545557 GGTCAGGCCAAGACTCAGGCTGG + Intronic
1068770100 10:60811165-60811187 GTAGAAGCCAAAACTTAAGTTGG - Intergenic
1069537433 10:69265415-69265437 TTAGAAGCCGAGACTCAAGAAGG - Intronic
1071482538 10:86075943-86075965 GTTGGGGCCAAGACTCATGCTGG + Intronic
1072636093 10:97179543-97179565 GATGAAGCCAGGATTCAAACTGG + Intronic
1072801551 10:98395592-98395614 GGTGTGGCCAGGACTCAAGCTGG - Intronic
1073618941 10:105026885-105026907 ATTGAAGCCATCACCCAAGCAGG - Intronic
1075637558 10:124039669-124039691 GGTGATGCCAAGACACAGGCAGG + Intronic
1075881633 10:125857292-125857314 GTGGAATCCAAGGCTGAAGCAGG + Intronic
1084481356 11:69422491-69422513 GATGAAGCCAACGCTCACGCAGG + Intergenic
1084691829 11:70732056-70732078 TCTGAAGCCAAGACTTGAGCAGG - Intronic
1087245472 11:95830682-95830704 GTTGAAGGAAAGACTCATGAAGG - Intronic
1088020084 11:105108541-105108563 TGTGAAGCCAAGACTGAAGTGGG + Intergenic
1090888909 11:130905462-130905484 GCTGAAGCCAACACTACAGCTGG + Intronic
1092403372 12:8196905-8196927 GTGGAAGGCAAGACAGAAGCAGG + Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1097401178 12:59129725-59129747 TTCCAAGCCAAGTCTCAAGCTGG - Intergenic
1104373638 12:128245576-128245598 GATGAAGCAAAGCCTCCAGCGGG - Intergenic
1104760517 12:131295273-131295295 AGTGAAGCCATGACTCAAGCAGG + Intergenic
1104819258 12:131665512-131665534 AGTGAAGCCATGACTCAAGCAGG - Intergenic
1106217451 13:27715846-27715868 GATGGAGGCAAGAGTCAAGCAGG + Intergenic
1111033714 13:82641841-82641863 GTTGACGCCACCACTCAAGGTGG + Intergenic
1112569549 13:100581286-100581308 GCTGAACCTAAGACTGAAGCAGG + Intronic
1114412384 14:22513253-22513275 GTTGGAGCCAAAAATCACGCTGG - Intergenic
1121918632 14:97859424-97859446 GTTCAAACCAAGAGTCAAGATGG - Intergenic
1122850883 14:104530096-104530118 GATGAAGACAAAACTCAAGGGGG + Intronic
1124683604 15:31758866-31758888 GTTGAAGCCCAGGCTAAATCAGG - Intronic
1124925378 15:34065401-34065423 GTTCACACCAAGACGCAAGCAGG + Exonic
1126583518 15:50262045-50262067 GATGAAGGCAAACCTCAAGCTGG + Intronic
1128341908 15:66828188-66828210 GTTGAAGACATGGCTCAAGGGGG - Intergenic
1129816240 15:78557013-78557035 GTTAAAGTCAAGACTCAGCCTGG - Intergenic
1130380199 15:83365423-83365445 TTTGACTCCAACACTCAAGCTGG - Intergenic
1130730455 15:86486902-86486924 TTGGCATCCAAGACTCAAGCTGG - Intronic
1131398043 15:92102505-92102527 GATGCAGCTAAGACTCAAGGAGG + Intronic
1132435835 15:101801719-101801741 GTTGAATCTAAGACAAAAGCAGG + Intergenic
1133540847 16:6751914-6751936 GTTAAAGCCTGGACTCACGCTGG - Intronic
1135923923 16:26675628-26675650 TTTGAAGCCCAAACTCAAGGAGG + Intergenic
1137754183 16:50888339-50888361 GGTCAAGCAAAGACTCAATCTGG - Intergenic
1140272380 16:73478754-73478776 GATAAAACCCAGACTCAAGCTGG + Intergenic
1150530569 17:65977219-65977241 GTTGATGCCAAGAGGAAAGCGGG - Intronic
1150658288 17:67055130-67055152 GATGAAGCCAAGGCTGAAGATGG - Exonic
1152735674 17:81995801-81995823 GCTGCAGACCAGACTCAAGCTGG + Intronic
1153488553 18:5626797-5626819 GGAGAAGCAAAAACTCAAGCAGG - Intronic
1155389737 18:25322151-25322173 CTTGAAGACAAGACTGAAGATGG - Exonic
1157790434 18:50526331-50526353 GTAGAATCCAAGACTAAAGATGG - Intergenic
1160127952 18:76195815-76195837 GCAGAGGCCAAGGCTCAAGCAGG + Intergenic
1160159692 18:76461768-76461790 GTTGGCGACAAGCCTCAAGCTGG - Intronic
1161432001 19:4238009-4238031 GTTGAAATGAAGACTCCAGCTGG + Intergenic
1166431048 19:42728508-42728530 GTTGAAGCCAAGCCTCCCCCGGG - Intronic
1166444051 19:42843748-42843770 GTTGAAGCCAAGCCTCCCCCGGG - Intronic
1166451486 19:42906301-42906323 GTTGAAGCCAAGCCTCCCCCGGG - Intronic
1166469885 19:43071084-43071106 GTTGAAGCCAAGCCTCCCCCGGG - Intronic
1166481021 19:43174599-43174621 GTTGAAGCCAAGCCTCCCCCGGG - Intronic
1166490599 19:43257586-43257608 GTTGAAGCCAAGCCTCCCCCGGG - Intronic
925164073 2:1704842-1704864 GTTAAAGGGAAGAGTCAAGCTGG - Intronic
926479688 2:13377155-13377177 GCCGAAGCCAAGACTGAAGAGGG + Intergenic
929934104 2:46281847-46281869 ATGGAAGCCAAGACTCAATGAGG + Intergenic
932496475 2:72148142-72148164 GATGAAGCCGTGAGTCAAGCTGG + Intergenic
936118283 2:109719932-109719954 TTTGATGTCAAGCCTCAAGCTGG + Intergenic
938283153 2:130081931-130081953 GTTGATGTCAAGACACAAACAGG + Intronic
938432457 2:131256968-131256990 GTTGATGTCAAGACACAAACAGG - Intronic
939780259 2:146437695-146437717 TTTGAAGCCAAGACTCAGGATGG - Intergenic
943353513 2:186822750-186822772 GAGGAGGCCAAGACTCCAGCAGG + Intergenic
944662088 2:201929620-201929642 GCTGAAGCTAGGACTCAGGCTGG - Intergenic
946229487 2:218282663-218282685 GTTGGAGCCAAGGCTCAAAGTGG + Intronic
946599690 2:221345953-221345975 GATGAAGCAAAGACTCCAACAGG - Intergenic
948923653 2:241080510-241080532 GGTGATTCCAAGACTGAAGCAGG + Intronic
1170816607 20:19719757-19719779 GTTCAAGCCAAGTCCCAATCTGG - Intronic
1175886618 20:62295418-62295440 GTGGACGCCAAGACACACGCAGG - Exonic
1179595810 21:42442441-42442463 GTTGAATCCAGAACTCAAACTGG + Exonic
1184390841 22:44202251-44202273 GTTGAAGCCAAGGCTGAGACTGG + Intronic
949143536 3:665835-665857 TTTGAAACCAAGACTCAGGATGG + Intergenic
949198434 3:1341772-1341794 GTTGAACCAAAGACTTAAGATGG + Intronic
951138231 3:19129676-19129698 GTTCAAGCCATGACAGAAGCGGG + Intergenic
954180795 3:48879943-48879965 CTCTAAGCCAAGATTCAAGCAGG + Intronic
954993087 3:54857695-54857717 ATTCAAGCCAAGACACCAGCAGG + Intronic
955883988 3:63578125-63578147 GTGCAATCCAAGGCTCAAGCTGG + Intronic
956296746 3:67723081-67723103 GCTGAAGGGAAAACTCAAGCTGG - Intergenic
956976463 3:74586782-74586804 ATTAAAGCCATAACTCAAGCAGG + Intergenic
958421153 3:93933276-93933298 GTTTAAACCAAGACTGAGGCTGG + Intronic
961304215 3:125944968-125944990 GTAGAATCAAAGACTCAAACAGG - Intergenic
961378521 3:126482533-126482555 GTGGGAGCCAAGACTCACGTGGG - Intronic
963712911 3:148768025-148768047 GTTAGAGCCAAGTATCAAGCTGG + Intergenic
964498947 3:157327047-157327069 GTCCAAGCCAGGACTCAAGAGGG + Intronic
965551953 3:169975372-169975394 GTTGAAGCCAAGAAGCAGACAGG + Intronic
967072042 3:185970963-185970985 TTTGAAGCCAAGAAGCAACCTGG - Intergenic
967358978 3:188608611-188608633 CTTGAAGCCAAGAACAAAGCCGG - Intronic
967829390 3:193905741-193905763 ATTGAAGCCAGGCCTCATGCTGG - Intergenic
969663978 4:8546373-8546395 GTTGAAGGGAAAAGTCAAGCTGG + Intergenic
969762695 4:9200955-9200977 GTGGAAGGCAAGACAGAAGCAGG - Intergenic
970899950 4:21147159-21147181 GTTGCAGCCAAGCCTCAGGGAGG - Intronic
971921861 4:32950888-32950910 GTTGAAGCAAAAACTCCAGTGGG + Intergenic
978924436 4:114226134-114226156 GTTCAGGTCAAGACTCAAGAAGG - Intergenic
980694575 4:136337981-136338003 TTTGCAGCCAACACTCAAGTGGG + Intergenic
984097317 4:175448662-175448684 GTTCAGGCCAAGACCCAGGCGGG + Intergenic
987991216 5:25215341-25215363 AATGAAGCCAAGAACCAAGCAGG + Intergenic
988708203 5:33746155-33746177 ATTCAAGACAAGACTCAGGCAGG + Intronic
990520341 5:56573378-56573400 CTTTGAGCCAAGGCTCAAGCTGG + Intronic
995367736 5:111382868-111382890 GCTTAAGCCAACACTCAAGTAGG - Intronic
995479907 5:112583389-112583411 GTTGAAGCCACAACTCTGGCAGG + Intergenic
996356471 5:122601023-122601045 CTTTAAGCCATGACTGAAGCTGG + Intergenic
996629100 5:125606410-125606432 GTTCAAGCCAAGCCTCCAGCTGG - Intergenic
997846296 5:137289032-137289054 GTTGAAGCCAAGACTCAAGCTGG - Intronic
998452980 5:142249233-142249255 GCTGAGGCCAAGCCACAAGCTGG - Intergenic
1003593501 6:7455282-7455304 GTTGCAGTCAAGAATCAACCAGG - Intergenic
1008920346 6:56837458-56837480 GTGGAAGGGAAGACTCAGGCAGG - Intronic
1010736825 6:79452668-79452690 TTGGAAACCAAGGCTCAAGCAGG + Intergenic
1011425445 6:87223831-87223853 GTTGATTCCAGGACTCAGGCAGG - Intronic
1012935220 6:105360391-105360413 GTAGAAGCCAAGACTTAAAAAGG - Intronic
1015168828 6:130228694-130228716 GTTGAAGAGAAGACTCAAGAAGG - Intronic
1016052418 6:139543859-139543881 GTAGAAAACAAGACTCAAGGAGG - Intergenic
1018050281 6:160003318-160003340 GTTGTATCCAAAACTCAACCAGG - Intronic
1018157987 6:161007216-161007238 TTTGATGCCAGGACTCAAGCAGG - Intronic
1018997895 6:168724364-168724386 AGTGAGGCCAAGACCCAAGCTGG + Intergenic
1023594014 7:41810048-41810070 GTTAGAGCCCAGACTGAAGCCGG + Intergenic
1027859545 7:83559193-83559215 GAAGAAACCAAGGCTCAAGCAGG - Intronic
1030573214 7:111252628-111252650 TTTGAAGCCAACACTAAATCGGG + Intronic
1030715301 7:112801730-112801752 GTTGAAGCAACAACTCCAGCAGG - Intergenic
1032158044 7:129486083-129486105 GTTGTAGCCAAGACTAAAGCAGG - Exonic
1034312388 7:150100132-150100154 GTGGAAGCCAAGGATCCAGCTGG - Intergenic
1034794469 7:154000532-154000554 GTGGAAGCCAAGGATCCAGCTGG + Intronic
1035671386 8:1420201-1420223 GCTGATGCAGAGACTCAAGCTGG - Intergenic
1036272788 8:7322691-7322713 GTGGAAGGCAAGACAGAAGCAGG - Intergenic
1036348562 8:7987657-7987679 GTGGAAGGCAAGACAGAAGCAGG + Intergenic
1036865201 8:12390441-12390463 GTGGAAGGCAAGACAGAAGCAGG + Intergenic
1042302076 8:67294908-67294930 GTTGATTCCAAGGCTGAAGCTGG + Intronic
1043209322 8:77491439-77491461 GTTGAAGGGAAGACTGAAGGTGG + Intergenic
1045062703 8:98423120-98423142 GTTGGGGCCAAGACTCTGGCAGG + Intronic
1046482587 8:114841618-114841640 TTTGCAGCCAACACTCAAGGAGG - Intergenic
1046708077 8:117477971-117477993 GTCAAAGTCAAGACTCTAGCTGG - Intergenic
1048386096 8:133913824-133913846 GGTGAAGAGAACACTCAAGCAGG + Intergenic
1049163527 8:141112459-141112481 GGTCAAGCCAAGACCCTAGCAGG + Intergenic
1049675726 8:143888051-143888073 GGTGGAGCCCAGACTCCAGCCGG + Intergenic
1050526123 9:6548328-6548350 CTTAAAGCCAATACACAAGCAGG + Intronic
1052941387 9:34134144-34134166 GATGACGCCAAGGCTCGAGCTGG - Intergenic
1056731526 9:89170104-89170126 GTCCAAACCAAGACTCAAGAGGG + Intronic
1058594600 9:106601969-106601991 GTTGAAGCACAGTCTCAAGTTGG + Intergenic
1058616229 9:106830901-106830923 TTTGAAGACAAGACACAAGTGGG + Intergenic
1191866006 X:65704401-65704423 GGCATAGCCAAGACTCAAGCTGG - Intronic
1195267914 X:103201403-103201425 GTTGAAGCCAAGAATCTCCCGGG + Intergenic
1195432571 X:104805827-104805849 GATGAAGCCAAGACTCCAAGAGG + Intronic
1197040402 X:121929769-121929791 CTTTTAGCCAAGACTGAAGCTGG - Intergenic
1198429531 X:136551782-136551804 GTTTAAGAGAGGACTCAAGCTGG + Intronic
1201227908 Y:11835783-11835805 GTTGACTCCAAGACTCCTGCTGG - Intergenic