ID: 997851603

View in Genome Browser
Species Human (GRCh38)
Location 5:137337962-137337984
Sequence ATAGAGAAACAGACTCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 2, 2: 7, 3: 86, 4: 511}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997851603 Original CRISPR ATAGAGAAACAGACTCAGGG AGG (reversed) Intronic
900864864 1:5261039-5261061 ATGAAGAAACTGACGCAGGGTGG + Intergenic
901624002 1:10613254-10613276 ATAAAGAAACAGAGTCATGTTGG + Intronic
901671268 1:10857693-10857715 AGAGAGGAAGAGAGTCAGGGAGG - Intergenic
901781816 1:11599247-11599269 ATAAGAAAACAGACTCAGAGAGG + Intergenic
902141783 1:14362898-14362920 ATAGAGAAACTGAGGCAGGAAGG + Intergenic
902405179 1:16178918-16178940 TTGAAGAAACAGGCTCAGGGAGG - Intergenic
902540341 1:17149838-17149860 GTGGAGTAACAGGCTCAGGGAGG + Intergenic
902733511 1:18384913-18384935 ATAGAGAGACAGAGACAGAGGGG + Intergenic
902767088 1:18624343-18624365 AGGAAGAAATAGACTCAGGGAGG - Intergenic
903131167 1:21280360-21280382 ATAAAGAAACAGACTGGGGTGGG + Intronic
903168326 1:21536767-21536789 AAGGGGAAACAGACTCTGGGTGG + Intronic
903549754 1:24149740-24149762 CTGGAGAAACAGACTCAGAGTGG + Intergenic
903765005 1:25728403-25728425 TGAGAGAAACAGGCTCAGGGAGG + Intronic
904206766 1:28860656-28860678 GTAGGGAAACAGAATCAGAGAGG + Intronic
904562233 1:31406653-31406675 ATAGAGAAACAGGCCCAGAAAGG + Intergenic
904617900 1:31759888-31759910 AGAGGGAAACAGGCTCAGGGGGG - Intronic
904790916 1:33020499-33020521 ATAAGGAAACAGCCTCAGAGAGG + Intronic
904844341 1:33397607-33397629 CCAGAGGAACAGACTCAGGAGGG - Intronic
905093567 1:35449626-35449648 ATGGAGAAACAAACTCAGAGAGG - Intronic
905102786 1:35540196-35540218 AAAGGGAAACAGAAGCAGGGAGG - Intronic
905652378 1:39665153-39665175 TTAGAGAAACTGAGGCAGGGAGG + Intronic
905732329 1:40305562-40305584 ATAGGGAAACAGGCCCAGGGAGG + Intronic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906529316 1:46514265-46514287 ACAGGGAAACAGACCCAGAGAGG - Intergenic
906750564 1:48255345-48255367 ATGAAGAAACAAACTCAGAGAGG + Intergenic
906782197 1:48582732-48582754 ATCGGGAAACAGATTCAGAGTGG + Intronic
907782201 1:57577560-57577582 ATAAAGAAACAGGCTCAGAGAGG + Intronic
907923376 1:58933375-58933397 ACAAAGATACAGACTCAGAGAGG - Intergenic
908579678 1:65501428-65501450 GAAGAGAAACAGACACAAGGAGG + Intronic
908775358 1:67634343-67634365 ATAAAGAAACAGATTCAGAGAGG - Intergenic
909662416 1:78098791-78098813 ATTTAGACACAGACACAGGGAGG + Intronic
910221756 1:84895077-84895099 ACAGAGAAACAGATTCAGAGAGG + Intergenic
910452050 1:87357389-87357411 ATAGAGAAACAGGCCCAGAGAGG - Intergenic
910454815 1:87386198-87386220 AAAGAGGAAAAGACTCTGGGGGG + Intergenic
910651538 1:89573672-89573694 ATAGAGAAGCAGGATCAGTGAGG - Intronic
910977412 1:92921301-92921323 CTATAGAAACACACTCAGGATGG + Intronic
911202837 1:95063448-95063470 ATACAGAAACTAACTCAAGGTGG - Intronic
911427530 1:97738317-97738339 AGAGAAAAACTGACTGAGGGGGG + Intronic
912730002 1:112093778-112093800 AGAGAGAGACAGAATGAGGGAGG + Intergenic
913147501 1:116006782-116006804 AAAGAGAAACAGAAACAGAGAGG - Intronic
913297009 1:117331817-117331839 GTAGAGAAACAGATCCAGAGGGG + Intergenic
914447147 1:147759727-147759749 ATGAAGAAACAGACTCAGTGAGG - Intronic
915614984 1:157030748-157030770 ATAGGGAAGCATGCTCAGGGAGG - Intronic
915743435 1:158137813-158137835 AAAGTGAAAAAGACTGAGGGTGG - Intergenic
916211877 1:162366369-162366391 ATGAGGTAACAGACTCAGGGAGG + Intronic
916425791 1:164678363-164678385 ATAGAGACACAGACCCGAGGAGG - Intronic
917043538 1:170832369-170832391 ATAGACAAACATTCTCAGGTGGG + Intergenic
917138742 1:171813540-171813562 ATAGAGCCACTGATTCAGGGGGG - Intronic
917747850 1:178027926-178027948 ACAGAGACATAGACTCAGAGAGG + Intergenic
918256174 1:182749953-182749975 ATGAAGAAACAGACTAAGAGAGG - Intergenic
918466433 1:184826075-184826097 AAATAGAAACACTCTCAGGGTGG + Intronic
919449784 1:197757217-197757239 ACAAAGAAACAGGCTCAGAGTGG + Intronic
920124840 1:203685737-203685759 AAGAAGAAACAGACTCAGGGAGG - Intronic
920919135 1:210283741-210283763 TTAGAGAAACAGAGTTAGGCTGG - Intergenic
921480727 1:215661887-215661909 ATGGCAAAACAGACCCAGGGAGG - Intronic
922504615 1:226119273-226119295 ATAAGGAAACAGTCTCAGAGAGG + Intergenic
924221199 1:241876906-241876928 ATAAACAAATAGGCTCAGGGAGG - Intronic
924560697 1:245154937-245154959 ATAAAGATCCAGACTCGGGGAGG - Intergenic
924934756 1:248758505-248758527 ATAAGGAAACAGGCCCAGGGAGG + Intergenic
1063594278 10:7419532-7419554 ATAGACAAAGAAACTGAGGGAGG + Intergenic
1063602577 10:7495755-7495777 AGAGAGAAACAGGCTGAGAGAGG + Intergenic
1063719973 10:8570200-8570222 ATTGAGAATGAGACCCAGGGTGG - Intergenic
1064836038 10:19532170-19532192 ACAAAGAAACAGACTCAAAGAGG + Intronic
1065699227 10:28408763-28408785 AGAGAGAAACAGACAAAGAGAGG - Intergenic
1066297322 10:34066198-34066220 TTAGAGACACAGACCAAGGGAGG + Intergenic
1067460206 10:46452584-46452606 ACACAGAAACACACACAGGGAGG - Intergenic
1067626984 10:47932019-47932041 ACACAGAAACACACACAGGGAGG + Intergenic
1067976200 10:51027998-51028020 ATAGATAAACACACTGAGGCAGG + Intronic
1069785552 10:70985814-70985836 AGAGAGAAGCAGACACAAGGTGG - Intergenic
1070748800 10:78951682-78951704 AAAAGGAAACAGCCTCAGGGAGG + Intergenic
1071476021 10:86025607-86025629 ATAAGAAAACAGACTCAGAGAGG + Intronic
1071950137 10:90693890-90693912 ATACAGAAACTGACTCAAGATGG - Intergenic
1072760688 10:98054078-98054100 AGAGAGAAACAGACTGAGAGAGG - Intergenic
1072885917 10:99273748-99273770 ATAGACAAACAGATGCAGGGAGG + Intergenic
1073163415 10:101421452-101421474 AAAAATAAACAGACCCAGGGAGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074164253 10:110860855-110860877 CCAGAGAAGCAGACTCAGGGAGG + Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074541635 10:114370040-114370062 ATGGGGAAACAGAGTCAGGGAGG - Intronic
1075015606 10:118908197-118908219 CTAGAGAAACAGGCTGAGTGGGG - Intergenic
1075103286 10:119520530-119520552 CTAAAGAAACAGACCCAGGGAGG + Intronic
1075721608 10:124590765-124590787 ACAGAGAAGCAGGCTCAGGAAGG - Intronic
1075948336 10:126456740-126456762 ATAGAGACACAGACGCAGGGAGG + Intronic
1076060886 10:127413180-127413202 ATAAAGAAATAGACACAAGGAGG + Intronic
1076147080 10:128131180-128131202 ATAGAGGAACAGACTAAGTGTGG - Intergenic
1078034829 11:7792730-7792752 ATAGAGCTACAGATTCAGGAAGG - Intergenic
1078708906 11:13771151-13771173 ATAGCAAAACAGACTGAGCGTGG - Intergenic
1078746211 11:14117872-14117894 ATAAGGAAACAGGCTCAGGGAGG - Intronic
1079100349 11:17537734-17537756 AGACAGAAAGAGACTCAGGCTGG - Intronic
1079379944 11:19929263-19929285 AAAAAGAAACAGACAAAGGGAGG + Intronic
1079975051 11:27080630-27080652 ATAAGGACACAGACTCAGGCAGG + Intronic
1080269054 11:30431390-30431412 ATTGGGAAACAGATTCAGAGAGG - Intronic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080691296 11:34560757-34560779 ATGAGGAAACAGACTCAGGCAGG + Intergenic
1080865742 11:36193356-36193378 AGAGGGAGAGAGACTCAGGGTGG - Intronic
1080920491 11:36704139-36704161 ATAAGGAATCAGACTCAGAGTGG - Intergenic
1081463265 11:43291207-43291229 AAAGAGAATCAGAGACAGGGAGG + Intergenic
1082792981 11:57359982-57360004 ATGGAAAAACAGACTCAGAGAGG + Intronic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1082812224 11:57485256-57485278 AGAGAGAAACAGAGTCAAGTAGG + Intronic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083233598 11:61338297-61338319 ATGTAGAAACAGATTCAGAGAGG - Intronic
1083776424 11:64896314-64896336 ATAGAGAAACAGCCACGGAGAGG - Intronic
1083786695 11:64953238-64953260 GTAAGGAAACAGACTCAGGGAGG + Intronic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084596840 11:70121690-70121712 ATAGAGAGACAGACAGAGAGAGG - Intronic
1084596888 11:70122101-70122123 ATAGAGAGACAGACAGAGAGAGG - Intronic
1084596920 11:70122375-70122397 ATAGAGAGACAGACAGAGAGAGG - Intronic
1084596934 11:70122514-70122536 ATAGAGAGACAGACAGAGAGAGG - Intronic
1084848046 11:71916263-71916285 AAAGAGAAACAAAATCAGGGGGG + Intronic
1084949477 11:72656826-72656848 ATGGGGAAACAGGCCCAGGGTGG - Intronic
1084952556 11:72674691-72674713 ATAGAGAAACACACACACAGAGG + Intergenic
1085025757 11:73235631-73235653 ATGGAGAAACAGGCCCAGAGAGG + Exonic
1085039254 11:73317375-73317397 ATAAAGAAGCAGGCTCAGAGTGG + Intronic
1085213688 11:74807784-74807806 ATACTGAAAAAGACTAAGGGAGG - Intronic
1085218154 11:74850182-74850204 ATGAAGCAACAGACTCAGAGAGG - Intronic
1085440118 11:76553780-76553802 ATGGAGAAACTGACTCGGAGAGG - Intergenic
1086577543 11:88357434-88357456 AAAGAGAAACTGACTTAGGTAGG + Intergenic
1086839362 11:91666633-91666655 AGAGAGACACAGAGCCAGGGGGG + Intergenic
1087288486 11:96293752-96293774 AAAGTGAAACAGACTCACAGAGG + Intronic
1087321132 11:96660235-96660257 TTAAAGAAACAGACTCAGCAAGG - Intergenic
1087338293 11:96870259-96870281 AAAGAGAAACAGCCTCAGTTAGG + Intergenic
1087511796 11:99103786-99103808 ATAGAGAAAGAGACACATAGGGG + Intronic
1088447302 11:109945868-109945890 ATGGAGAAACAGAAACATGGAGG - Intergenic
1088884543 11:113996695-113996717 ATAGAAAAGCAGAGTCATGGAGG + Intergenic
1089257446 11:117201270-117201292 ATAAGGAAACAGACGCAAGGAGG + Intronic
1089860759 11:121588214-121588236 ATAGAGACACAACCCCAGGGTGG - Intronic
1090220094 11:125012677-125012699 ATATATAAACAGAATCAAGGTGG + Intronic
1092752631 12:11733027-11733049 ATGGAGAAACAGAGTCTGAGTGG - Intronic
1093483635 12:19629778-19629800 ATGAAGAAACAATCTCAGGGAGG + Intronic
1093936900 12:25011111-25011133 ATAAAGAAACAGGTTCAGAGAGG + Intergenic
1095628672 12:44348290-44348312 ATAGAGAAATATACTCTGGTGGG + Intronic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1096845868 12:54406099-54406121 ATAGTGAAGCAGACATAGGGTGG - Intronic
1096871569 12:54595832-54595854 ACAGAGAAAGAGCCTGAGGGTGG - Intergenic
1097391840 12:59024725-59024747 AAAGAGAAGCAGAGTCAGTGAGG - Intergenic
1098029583 12:66240237-66240259 ACAGGGAAACAGGCTTAGGGGGG + Intronic
1098161649 12:67651091-67651113 ATAGAGAGACAGACAGAGGGAGG - Intronic
1098401444 12:70080866-70080888 ATTGAGAAACAGCAGCAGGGAGG + Intergenic
1098503714 12:71224765-71224787 AGAGAAAAACAGAATCAGGCTGG - Intronic
1098662056 12:73107189-73107211 GTATAGAAACAGTCTCAGTGTGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100120586 12:91364888-91364910 CTACTGAAACAGACTGAGGGAGG - Intergenic
1100657167 12:96659592-96659614 ATGGAGAAATAGACTCATGAAGG + Intronic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101625810 12:106440174-106440196 ATAGAGAAAAAGGGTCAGGACGG - Intronic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101853795 12:108425532-108425554 CAGGACAAACAGACTCAGGGAGG + Intergenic
1102030751 12:109738865-109738887 TTTGGGAAACAGACTCAGAGAGG + Intronic
1102210579 12:111123894-111123916 ATAAGGAAACAGGCTCAGAGGGG + Intronic
1103151283 12:118641206-118641228 ATGGAGGAAGGGACTCAGGGAGG + Intergenic
1103247650 12:119471827-119471849 ATAGAGAAAGAGAGTGAGAGAGG - Intronic
1103253176 12:119518486-119518508 AATGAGAATCAGACTCAGAGAGG - Intronic
1104360919 12:128132482-128132504 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1104739653 12:131163631-131163653 ACAGAGAAACAGGGTCAGGCCGG - Intergenic
1104847981 12:131856461-131856483 ACAGAGAGACAGAGACAGGGAGG - Intergenic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1104923408 12:132303064-132303086 AGAGAGAGACAGACAGAGGGTGG - Intronic
1105324718 13:19359901-19359923 GCAAGGAAACAGACTCAGGGAGG + Intergenic
1105868643 13:24484114-24484136 GCAAGGAAACAGACTCAGGGAGG - Intronic
1106256064 13:28022932-28022954 TTAGACAAAGACACTCAGGGTGG + Intronic
1108505467 13:51108689-51108711 ACAGAAAAACAGACCCAGAGAGG + Intergenic
1109897923 13:68718759-68718781 ATTGGAAAACAGACTCAGGCAGG + Intergenic
1109903601 13:68808118-68808140 ATAGAGAAAAAGACTCTGAAAGG + Intergenic
1111651416 13:91094992-91095014 ATCCAGAAACAGCCTCTGGGAGG + Intergenic
1112924206 13:104653690-104653712 AGAGAGAAACAGACAAAGAGGGG + Intergenic
1115150177 14:30275786-30275808 ACAGAGAATCAGGTTCAGGGAGG + Intergenic
1117662321 14:58020494-58020516 ATAGAGAAAGAGACAAGGGGAGG - Intronic
1118668423 14:68095992-68096014 AAAAAGAAACAGACTCAGAAAGG + Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119568270 14:75647128-75647150 ACAGAGATACCGACTCAGGAGGG + Exonic
1119613807 14:76085132-76085154 ATGAGGAAACAGACTCAGAGAGG + Intergenic
1120072520 14:80120057-80120079 AAAGAGAAGCAGAGTCAGGTGGG - Intergenic
1120111896 14:80567066-80567088 ATTTAAAAACAGACTCAAGGTGG + Intronic
1120785905 14:88535485-88535507 ATTAAGAAACAGACTCAGTGAGG - Intronic
1120967792 14:90182866-90182888 AATAAGAAACTGACTCAGGGAGG + Intronic
1121047743 14:90800284-90800306 AGAGAGAAATAGACTGAGTGGGG + Intronic
1121105023 14:91273906-91273928 ATAAGGAAACAGACCCAGAGAGG + Intronic
1121452985 14:94021226-94021248 ATAGAGGAACTGACTGAGGCTGG + Intergenic
1121844677 14:97162322-97162344 ATACACAAACAGGCTCAGGCTGG - Intergenic
1122861766 14:104585795-104585817 ATAGAGACACAGAATCGGCGGGG + Intronic
1122971312 14:105153389-105153411 ACAGAGACCCAGGCTCAGGGCGG + Intronic
1202943110 14_KI270726v1_random:1727-1749 ATAGAGAAACAGACTCTCACAGG - Intergenic
1124625867 15:31307199-31307221 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1125228277 15:37421351-37421373 AAAGAGTAACAGACTCAGAAAGG - Intergenic
1125747562 15:42007523-42007545 AAAGAGAAATAGACTCAGAGAGG + Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1127226293 15:56933577-56933599 TAAGATAAACAGACTCAGAGAGG - Intronic
1127428590 15:58880498-58880520 ACAGAGAAAGAAACTGAGGGTGG + Intronic
1127862256 15:63004118-63004140 ATAAGGAAACAGACCCAGAGAGG - Intergenic
1128308093 15:66613291-66613313 AGAGAGAAAGAGACCCAGAGAGG + Intronic
1130300836 15:82679108-82679130 AAAGAAAAAAAGACTCTGGGAGG - Intronic
1131126356 15:89860843-89860865 ATAGAGAAACAGAGGCAGCCAGG + Intronic
1131336076 15:91550444-91550466 AAAGAGAAACACATTCAAGGGGG - Intergenic
1131864010 15:96687533-96687555 ATGAGGAAACAGGCTCAGGGAGG + Intergenic
1132001979 15:98189842-98189864 ATAGGGAAACAGACTTAGCAAGG + Intergenic
1132149332 15:99448179-99448201 CTAGAGAAGCAGAGGCAGGGAGG + Intergenic
1132153339 15:99477609-99477631 TTGAAGAAACAGGCTCAGGGAGG + Intergenic
1132617196 16:847535-847557 AGAGAAAAAGAGGCTCAGGGAGG + Intergenic
1133398854 16:5470095-5470117 AAAGGGAAACAGACTCAGCAGGG + Intergenic
1134181956 16:12055077-12055099 CTAGAGAAACAGAACCAGTGTGG + Intronic
1134316808 16:13126536-13126558 AGAGAGAAAGAGACTGAGGGAGG + Intronic
1134316818 16:13126586-13126608 AGAGAGAAAGAGAGACAGGGAGG + Intronic
1134878134 16:17720418-17720440 ATGGGAAAACACACTCAGGGAGG + Intergenic
1135249311 16:20887498-20887520 TTAAAGAAACAGACTGAGAGGGG + Intronic
1135485184 16:22858717-22858739 ATACAGAAACAGACTCAGAGAGG - Intronic
1136060334 16:27721959-27721981 ATAAGGAAACAGACACAGAGAGG + Intronic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1136620471 16:31425051-31425073 AGAGAGAAACAGGCTTAGAGAGG - Intronic
1137024048 16:35455773-35455795 ATGAGGAAACAGTCTCAGGGAGG + Intergenic
1137812796 16:51368803-51368825 ATGAAGAAACAGATTCAGAGAGG + Intergenic
1138206547 16:55129815-55129837 AGAGGAAAACAGACACAGGGAGG + Intergenic
1138498161 16:57421316-57421338 ATGGAGAAATAGGCTCAGGCAGG - Intergenic
1138553143 16:57758016-57758038 ACAGAGAAAGTGACCCAGGGTGG + Intergenic
1138644834 16:58417144-58417166 ATAAAGAAATAGACTCAGTGAGG + Intergenic
1139153341 16:64411271-64411293 TTAGAGATTCAGAATCAGGGAGG - Intergenic
1139194650 16:64905098-64905120 CAAGAGAAACACACTGAGGGTGG + Intergenic
1139465145 16:67150408-67150430 ATAGAGTAAGAGGCCCAGGGAGG + Exonic
1140183520 16:72745275-72745297 ATTGAGAAACAGACCCAGTGAGG - Intergenic
1140635440 16:76907782-76907804 ACAGAAATACAGACTGAGGGAGG - Intergenic
1141346195 16:83248276-83248298 AAGGAGAAACAGAGGCAGGGGGG + Intronic
1141768625 16:86075039-86075061 ATGGAGAAACAGGCCCAGGGTGG - Intergenic
1141772681 16:86100799-86100821 ATAGGGAAACAGAAAAAGGGTGG + Intergenic
1141883734 16:86877831-86877853 AGAGAGAGACAGAGACAGGGAGG - Intergenic
1142145713 16:88492170-88492192 AGAGAGAAAGAGAGGCAGGGAGG - Intronic
1142150290 16:88509658-88509680 GTGGAGAAACAGGCCCAGGGAGG + Intronic
1142326125 16:89415853-89415875 ATGGAGAACCAGCCTCAGTGAGG + Intronic
1142687842 17:1587959-1587981 ATTGAGAAACAGAATTAAGGGGG - Intronic
1142960841 17:3551649-3551671 ACAGAGATACAGACTGATGGAGG - Intronic
1143114587 17:4575556-4575578 ACAGAGAAACAGAGACTGGGAGG + Intergenic
1143118046 17:4591661-4591683 ACAGGGAAACAGACCCAGAGGGG + Intronic
1143374768 17:6461015-6461037 AGAGACAAACAGAACCAGGGGGG - Intronic
1144375145 17:14632307-14632329 AGAAAGTAAGAGACTCAGGGAGG - Intergenic
1144395361 17:14837913-14837935 ATGAAGAAACAGACTAAGTGAGG - Intergenic
1144822078 17:18082292-18082314 ATGTAGAAACAGGCTCAGAGAGG + Intergenic
1144840273 17:18181811-18181833 ATAGGGAAACAGGCCCAGAGAGG - Intergenic
1144966324 17:19078936-19078958 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1144981594 17:19173121-19173143 TTGAGGAAACAGACTCAGGGAGG - Intergenic
1144986630 17:19205118-19205140 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146504888 17:33396161-33396183 ATAAAGAAACAGACCCAGAGAGG + Intronic
1146913709 17:36664807-36664829 ATGGAGAAACTGAGTCTGGGAGG + Intergenic
1147740679 17:42669628-42669650 ACAGAGAGGCAGAGTCAGGGTGG + Intronic
1148049633 17:44763282-44763304 ATGGAGAAACAGGCACAGAGAGG + Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1149398742 17:56271861-56271883 AGAAGGAAACAGCCTCAGGGAGG - Intronic
1149719123 17:58825660-58825682 CTAGAGAATCAGACTGAGGCTGG - Intronic
1150624301 17:66831843-66831865 ATAGAAAAAGAGACCCAGGGTGG + Intergenic
1150776920 17:68088486-68088508 ATGGGGAAACAGACTCAATGAGG + Intergenic
1151362100 17:73595292-73595314 ACAGAGAAATAGAGTCGGGGTGG + Intronic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153711231 18:7801505-7801527 AAAGTGAAACAGCCTCAGGTAGG - Intronic
1153763850 18:8356501-8356523 AAACAGAAACACACTCAGGATGG + Intronic
1153849773 18:9082338-9082360 AATAAGAAACAGACTAAGGGAGG - Intergenic
1154940769 18:21111276-21111298 GTAGAGAAAGAGAAGCAGGGTGG + Exonic
1155159445 18:23183880-23183902 ATAAACAAAAAGCCTCAGGGCGG - Intronic
1155262376 18:24056465-24056487 TTAAAGAAACATACTCAGTGAGG + Intronic
1155706712 18:28824362-28824384 ACAGAGGAACAGACTCAGGATGG - Intergenic
1155945150 18:31840364-31840386 ATAGAGAGACAGAGGGAGGGAGG + Intronic
1156504293 18:37579382-37579404 AAAGAGAGACAGACTGATGGAGG - Intergenic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1157830476 18:50852618-50852640 GCAGAGTAACAGAATCAGGGAGG - Intergenic
1158435419 18:57432119-57432141 ATAGAGAGACACACACAGAGAGG - Intergenic
1160066637 18:75581512-75581534 CTAGACAAACACACTCACGGTGG - Intergenic
1160950602 19:1665493-1665515 ATAGAGGAAAGGACTCAGGATGG + Intergenic
1161242057 19:3228198-3228220 ACAGAGAAACACAGACAGGGAGG + Intronic
1161992084 19:7689949-7689971 ATAGAGGAAGGGGCTCAGGGAGG - Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1162594120 19:11613856-11613878 AAAGATACACAGTCTCAGGGTGG + Intronic
1163270290 19:16248856-16248878 ACAGAGAAACAGGCCCAGAGAGG - Intergenic
1163288795 19:16365214-16365236 ATTAAGAAACAGGCTGAGGGGGG - Intronic
1163398704 19:17078852-17078874 ATACAGAAACAGGCCCAGGCAGG + Intronic
1163778314 19:19231228-19231250 ATAGGGAGACAGACACAGAGAGG + Intronic
1164663348 19:30000054-30000076 TTAGAGAAGCAGAGACAGGGAGG - Intronic
1164986863 19:32654648-32654670 AAAGAAAAAAAGAATCAGGGAGG - Intronic
1165112036 19:33508087-33508109 AAGGAGAAACAGCTTCAGGGAGG - Intronic
1165314003 19:35043886-35043908 AAAGAGAAACAGACACAAAGTGG + Intronic
1165617425 19:37214251-37214273 TTAGAGAGACAGACAAAGGGAGG - Intronic
1166288945 19:41849434-41849456 ATAGAAAAACAGGCTCAGAGAGG - Intronic
1166351738 19:42202050-42202072 ATGGGGAAACAGGCTCAGAGAGG - Intronic
1166625369 19:44347433-44347455 ATAGAGGGACAAAATCAGGGAGG - Intronic
1166799112 19:45444855-45444877 ATACAGAAACAGAGTCAGAGAGG - Intronic
1167196056 19:48029532-48029554 ACAGAGACACAGCCTCTGGGTGG + Intergenic
1167552272 19:50169407-50169429 AGAGAGACAGAGACCCAGGGAGG - Intergenic
1167621963 19:50565753-50565775 AGGGAGCCACAGACTCAGGGAGG - Intronic
1167702339 19:51056881-51056903 ACAGAGAAGGAGACTCAGAGAGG + Intronic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168592427 19:57648461-57648483 AAAGAAAGACAGACTGAGGGTGG + Intergenic
925064140 2:916037-916059 GTAGAGAAACAAATTCAGTGCGG + Intergenic
925225917 2:2184068-2184090 AGAGAGAAACAGAGAGAGGGAGG + Intronic
925260434 2:2524031-2524053 AAAGAGAGACAGACTCCAGGAGG - Intergenic
925778775 2:7360273-7360295 AGAGAAATAAAGACTCAGGGAGG - Intergenic
925786184 2:7433118-7433140 TCAGGGAAACAGACTGAGGGTGG - Intergenic
927740062 2:25560734-25560756 CTAGAGAAACAGACTCAATAGGG - Intronic
928186148 2:29113135-29113157 ATGAAGAAGCAGACTCTGGGAGG - Intronic
928204153 2:29272115-29272137 AGAGAGAGACAGTCACAGGGAGG + Intronic
928233424 2:29519863-29519885 ACAGAGAAACAAAATCATGGAGG + Intronic
928949434 2:36801365-36801387 ATAGAGAAAATTACTCAGAGAGG + Exonic
929411560 2:41702642-41702664 ACAGAGAGACACACACAGGGAGG - Intergenic
929429392 2:41874307-41874329 ATGAAGAAACAAACTCAGAGAGG + Intergenic
929769803 2:44882080-44882102 ATAAGGAAACAGACTCAGAGAGG - Intergenic
929804569 2:45133274-45133296 ATAGATCAAGAGGCTCAGGGAGG - Intergenic
929817350 2:45244010-45244032 ATAGAACAACAGAGTCAGGGAGG + Intergenic
929902858 2:46020964-46020986 CTAAGGAAACAGACTCAGGGAGG + Intronic
930025001 2:47024460-47024482 ATAAGGAAACAAACTCAGGGAGG - Intronic
931108496 2:59084247-59084269 ATACACAAACAGACTCTGGGTGG - Intergenic
931144466 2:59502061-59502083 GTAAAGAAACAGGCTCAGAGAGG - Intergenic
933843735 2:86308589-86308611 TTAGGGAAGCAGACCCAGGGCGG - Intronic
935046145 2:99484900-99484922 ATAAAGAAACAGATTTAGAGAGG - Intronic
935489497 2:103698857-103698879 ATAGAGAACCAGCAGCAGGGTGG - Intergenic
935966178 2:108478934-108478956 ATAGAAAAACATACTTTGGGAGG + Intronic
936831221 2:116650120-116650142 ATATAGAAACAGAGACACGGAGG + Intergenic
937366286 2:121264351-121264373 ATAGAGGAGCAGTCTCAGAGAGG - Intronic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
937648810 2:124297325-124297347 TGAGAGAGACAGGCTCAGGGAGG - Intronic
937682706 2:124661547-124661569 AAAGTGAAACAGCCTCAGGCAGG - Intronic
937816621 2:126257991-126258013 ACAGAGACACAGACTCACTGGGG + Intergenic
940926071 2:159364850-159364872 ATACAAGAACAGACTCAGGCAGG + Intronic
941693500 2:168526582-168526604 ACAGAAAAACTGACTCAGGGAGG + Intronic
942086014 2:172444689-172444711 GTAGAGAAAGAAACTCAGGGGGG - Intronic
943114548 2:183650469-183650491 ATAGTGAAAAAGACTCAAGAAGG + Intergenic
943894793 2:193342575-193342597 ATAAAGAAACAGACCAAGAGAGG - Intergenic
944175471 2:196823860-196823882 ATGAAGACACAGACTCAGAGAGG + Intergenic
944786792 2:203079525-203079547 ATAGAGAAAGAAACAGAGGGAGG - Intronic
945151495 2:206796618-206796640 CTAGAGAAACCTGCTCAGGGTGG - Intergenic
945869946 2:215216432-215216454 GGAGAGAATTAGACTCAGGGAGG - Intergenic
946666114 2:222051581-222051603 AGAGAGAAACAGACACAGAAAGG + Intergenic
947379402 2:229530656-229530678 ATAGAGAAACTGACTCCAGAAGG - Intronic
947611846 2:231529753-231529775 ATAGGGAAACAGCCTCAGAGAGG - Intronic
948795822 2:240401678-240401700 ACAGAGAGACAGACACAGAGGGG - Intergenic
1168960937 20:1869210-1869232 ATAAGGAAACAGGCTCAGAGAGG - Intergenic
1169439995 20:5625958-5625980 AAAGAAAAACAGCCTCAGGTTGG + Intergenic
1169807040 20:9570069-9570091 ATAAGGAAACAGACTCACAGAGG - Intronic
1169937889 20:10904446-10904468 TTAGAGAACCAGGCTCAGAGAGG + Intergenic
1170075195 20:12411209-12411231 TTCTAGAAACAGAGTCAGGGAGG - Intergenic
1170090216 20:12582492-12582514 ATCAAGAAACAGCCTCGGGGAGG + Intergenic
1170258640 20:14376886-14376908 ATAAGAAAACAGATTCAGGGAGG - Intronic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1171363271 20:24605433-24605455 ACAGAGATACAGACTGGGGGAGG - Intronic
1173129965 20:40382968-40382990 ACAGGGAAGGAGACTCAGGGTGG - Intergenic
1173671186 20:44800006-44800028 ATGAGGAAACAGGCTCAGGGAGG + Intronic
1174057614 20:47809549-47809571 CTGGGGAAACAGGCTCAGGGAGG + Intergenic
1174061240 20:47834413-47834435 ATGGAGCTGCAGACTCAGGGAGG - Intergenic
1174070536 20:47896286-47896308 ATGGAGCTGCAGACTCAGGGAGG + Intergenic
1174153634 20:48503079-48503101 ATGGAGGTACAGACCCAGGGAGG - Intergenic
1174260661 20:49292561-49292583 ATAGCAAAACAGGCTCAGGGAGG + Intergenic
1174509505 20:51040471-51040493 ACAGAGATACAGACACAGAGCGG - Intergenic
1174837113 20:53866985-53867007 AAAGAGAACCAGGCTAAGGGTGG + Intergenic
1175768153 20:61605404-61605426 ATAGAGAAACAGACAAAGAGAGG - Intronic
1175808845 20:61846526-61846548 ATAGAGATACAGAGACAGAGAGG + Intronic
1175982385 20:62745281-62745303 ACAGAGAAACAGACACATAGAGG + Intronic
1178205930 21:30465079-30465101 ATAAAGAAACTGAATCAGAGAGG - Intergenic
1179188570 21:39104338-39104360 ATAGAGAAACAGAAAGAAGGAGG + Intergenic
1180746791 22:18094909-18094931 ACAGCAAAACAGACTCAGAGGGG + Exonic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1181853671 22:25767799-25767821 ATTAAAAAACAGACTCAGAGAGG + Intronic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182590656 22:31377147-31377169 ATACAGAAACAGAAGGAGGGGGG + Intergenic
1182747251 22:32615475-32615497 ATGGAGAAATGGAGTCAGGGAGG + Intronic
1182773259 22:32811212-32811234 AAAGATAAGCAGACTGAGGGGGG + Intronic
1182933109 22:34193844-34193866 ATAAGGACACAGACCCAGGGAGG - Intergenic
1183321628 22:37168521-37168543 ATGCAGAAACAGGCTCAGAGAGG - Intronic
1184235399 22:43180477-43180499 AGAGAGTGACAGAATCAGGGGGG + Intronic
1184379433 22:44135868-44135890 ACACAGAAACAGACAGAGGGAGG - Intronic
1184517546 22:44971929-44971951 ATAAGAAAACAGGCTCAGGGAGG + Intronic
1184574703 22:45353736-45353758 ATGAAGAAACAGACCCAGAGAGG + Intronic
949535595 3:4993770-4993792 ATAAGGAAACAGATTCAGGAAGG - Intergenic
949630877 3:5924717-5924739 ATAGAAAAACAGACAGAGTGGGG + Intergenic
950002534 3:9668313-9668335 AAAGAAAAACAGGCTAAGGGAGG - Intronic
950152766 3:10700822-10700844 TCAGAGAACCAGACTGAGGGAGG + Intronic
950180785 3:10911756-10911778 ATAAGGAAACAGCCTCAGAGAGG + Intronic
950432404 3:12958402-12958424 ACTGAGAAACAGACACAGAGAGG - Intronic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
950687868 3:14631748-14631770 AGAGAGATGCAGACACAGGGAGG + Intergenic
952094928 3:29939494-29939516 ATGGACATACAGACCCAGGGTGG + Intronic
954756608 3:52843803-52843825 AAAGAGAAGCAGACTCAGTGAGG + Intronic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955393512 3:58537861-58537883 GTAAGGAAACAGGCTCAGGGAGG + Intergenic
955614022 3:60786508-60786530 ATGAAGTAACAGACTCAGGTAGG - Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956687061 3:71839892-71839914 ATAGAGAAACAGGCTTAGAGAGG + Intergenic
957283371 3:78183323-78183345 TAAGAGAAACAGACTCTGAGAGG - Intergenic
957802988 3:85109352-85109374 ATAGAGAAAGAGAGACAGTGGGG + Intronic
958736642 3:98016636-98016658 ATAGAAAAACAAACTGAAGGGGG + Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959145304 3:102537238-102537260 GTACAAAAACAGAATCAGGGTGG - Intergenic
959656300 3:108808621-108808643 TTAGAGATTCAGATTCAGGGAGG - Intergenic
960108650 3:113824131-113824153 ATAGAAAAACAGGCTTAGGCTGG - Intergenic
960502323 3:118453250-118453272 AGAGAGAAAGAGAGTGAGGGAGG - Intergenic
960535938 3:118814298-118814320 ACAAGGAAGCAGACTCAGGGAGG - Intergenic
960701288 3:120441854-120441876 ATGGGGAAACAGGCTCAGAGAGG + Intronic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961328765 3:126126904-126126926 ATGGAGAGACAGACTCACAGTGG + Intronic
961359571 3:126358333-126358355 ATGAAGAAACCGACTCAGAGAGG + Intergenic
961410259 3:126715289-126715311 ATGAAGAAACTGAGTCAGGGAGG - Intronic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
963274988 3:143320911-143320933 ATAGAGACACAGACACATGGAGG + Intronic
963345924 3:144096732-144096754 AAGGAGAGAGAGACTCAGGGTGG - Intergenic
963560471 3:146857809-146857831 ATAGAGAGATATACTCATGGTGG + Intergenic
964036232 3:152200757-152200779 ATAGAAAAGTAGACTTAGGGAGG - Intergenic
964690850 3:159448066-159448088 CTAAGGAAACAGACTCAGAGTGG - Intronic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
965427084 3:168539888-168539910 TTTGAGAATCAGACTCATGGTGG - Intergenic
965707780 3:171526369-171526391 ATAGAGATACATTCACAGGGTGG + Intergenic
965847389 3:172980047-172980069 ATAGAGAACCAGACAAAGGAAGG - Intronic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966660998 3:182414807-182414829 ATGGAGAAACAGACCCAGTTTGG + Intergenic
967191297 3:186987165-186987187 AAAGAGAAAGAGAGACAGGGAGG + Intronic
968818789 4:2835079-2835101 TTAATGAAACAGACTCAGGGAGG + Exonic
969216866 4:5730131-5730153 ACAGATAAACAGACTGAGGCAGG - Intronic
969296694 4:6274448-6274470 ATGGGGAAACAGACACAGTGAGG + Intronic
969933685 4:10659403-10659425 AAAGAAAATGAGACTCAGGGAGG + Intronic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970147705 4:13054182-13054204 ATAGAGAAACAAAATCTGGAGGG - Intergenic
970563860 4:17311676-17311698 ATAGGGAAACAGAGAAAGGGTGG - Intergenic
970696917 4:18688679-18688701 ATAGGCAAACATACTAAGGGAGG - Intergenic
970947551 4:21712932-21712954 AAAGAGAAGCAGACACAGGGAGG - Intronic
972437520 4:39047953-39047975 ATAAGGAAATAGATTCAGGGAGG - Intronic
973646188 4:52953475-52953497 ATAAAGAAACAAGCTCAGGGAGG + Intronic
976276236 4:83281766-83281788 ATACAGAAACTGACGCAGAGAGG + Intronic
976437888 4:85039908-85039930 ATATGCAAACAGACTCATGGAGG + Intergenic
978197948 4:105992108-105992130 AAAAAGAAACAGAGTCAGAGAGG - Intronic
978323209 4:107521269-107521291 ATAAGGAAACAGTCTCAGGGAGG - Intergenic
978428963 4:108612543-108612565 ATAAAGAGACAGTCTCAGTGAGG + Intergenic
979472380 4:121114708-121114730 AAAAAGAAACACACTCAGAGGGG + Intergenic
980311054 4:131129196-131129218 ATAGAGAAACAGATTCACTCAGG - Intergenic
982882089 4:160731948-160731970 AGAGAGAAAGAGACAGAGGGAGG - Intergenic
982995055 4:162333145-162333167 ATAGAGAAAGAGATACAGGTGGG + Intergenic
983576943 4:169270743-169270765 AGAGAGAGACCGACCCAGGGCGG + Intronic
984032182 4:174617969-174617991 ATTGAGAAAAAGAGTCAGGCTGG + Intergenic
984710142 4:182878009-182878031 ATAATGGAACAGACTAAGGGTGG - Intergenic
985006779 4:185542103-185542125 ACAGAGAGAGAGACTCAGGGTGG + Intergenic
985666956 5:1186311-1186333 AGAGAGAAACAGAGACAGAGAGG - Intergenic
986064154 5:4219577-4219599 AGAGAGAGAGAGACTCAGGATGG + Intergenic
986314437 5:6576963-6576985 ACAGAGAAACAGGGACAGGGAGG + Intergenic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
987507978 5:18798071-18798093 ATACAGAGACAGACGGAGGGAGG + Intergenic
987775941 5:22366251-22366273 CTAGATAAATAGACTGAGGGTGG - Intronic
988979656 5:36553941-36553963 AAGGAGAGGCAGACTCAGGGTGG + Intergenic
989094226 5:37766388-37766410 AGAGAGAAACACACACAGAGGGG + Intergenic
989405798 5:41059111-41059133 AAAGAGAAACAGAGTCAGGTGGG - Intronic
989800367 5:45530932-45530954 ATAGACAAAAAGACTAATGGTGG + Intronic
990535720 5:56719962-56719984 AGAGGGAATGAGACTCAGGGAGG + Intergenic
992116411 5:73542505-73542527 AGAGAGAAACAGAGACAGAGAGG + Intergenic
992483796 5:77176609-77176631 GTAGGGAAACAGGCTCAGTGTGG - Intergenic
995082634 5:108071629-108071651 ACAGAGAAAGAGACTAAGAGAGG - Intronic
995798463 5:115965048-115965070 ATGAGGAAACAGACTCAGAGAGG - Intronic
996506351 5:124271565-124271587 ATAGAGAAAAAGACCCAGACTGG - Intergenic
997235307 5:132269072-132269094 ATAAAGAAACAGGTTCAGAGAGG + Intronic
997851603 5:137337962-137337984 ATAGAGAAACAGACTCAGGGAGG - Intronic
998160086 5:139808439-139808461 GAAGAGAAACAGACCCAGAGGGG + Intronic
998532559 5:142899452-142899474 ATAGAGAAGGAGGCACAGGGAGG + Intronic
998637494 5:143972156-143972178 ATAGAGACACAGACACAAGGAGG - Intergenic
998902939 5:146875396-146875418 AGAGAGAAAGAGACTGAGAGAGG + Intronic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999461093 5:151758258-151758280 ACAGAGAAACAGAACCAGAGAGG - Intronic
999479949 5:151938908-151938930 ATAGGGAAACAGACTCCAGGAGG + Intergenic
999665024 5:153904039-153904061 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
999945933 5:156595536-156595558 CTAGGGGACCAGACTCAGGGAGG - Intronic
1000380199 5:160622213-160622235 ATGAGGAAACAGACCCAGGGAGG + Intronic
1000585771 5:163096795-163096817 ACAGAGAAAAAGACAGAGGGAGG + Intergenic
1000930879 5:167249811-167249833 ATAGAGAAACACATTTAGAGAGG - Intergenic
1001143697 5:169166021-169166043 ATAAAGAAACAGAAACAGGGAGG + Intronic
1001553855 5:172623069-172623091 ATTAAGAAACAGGCTCAGAGAGG - Intergenic
1001878964 5:175226268-175226290 AAAGGCAAACAGGCTCAGGGAGG - Intergenic
1002569818 5:180133975-180133997 ATAGGGAAACTGGCTCAGAGAGG + Intronic
1002906545 6:1453760-1453782 ACAAAGAAATAGACTCAGGGAGG - Intergenic
1004111501 6:12723150-12723172 CAAGAGAAACAGACCCTGGGAGG + Intronic
1004607794 6:17210051-17210073 ATCTAGGACCAGACTCAGGGTGG - Intergenic
1004610540 6:17235477-17235499 ATACAGAAATTCACTCAGGGGGG + Intergenic
1004740799 6:18458666-18458688 ATAGGGAAACAGACTCACAGAGG - Intronic
1005279070 6:24251659-24251681 ATAGAAATAGAGACACAGGGAGG - Intronic
1006155739 6:32011944-32011966 ATAGAGAAACGGGGGCAGGGAGG - Intergenic
1006162070 6:32044798-32044820 ATAGAGAAACGGGGGCAGGGAGG - Intronic
1006428651 6:33981942-33981964 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1006538810 6:34722581-34722603 ATGGAGACACAGACTCAAAGAGG + Intergenic
1007096969 6:39219234-39219256 GGAGATAAACAGACTCAGGCAGG + Intronic
1007250469 6:40491621-40491643 AGAGGGAAACACACTCAGAGAGG - Intronic
1007250531 6:40492079-40492101 AGAGGGAAACACACTCAGAGAGG - Intronic
1007576545 6:42928885-42928907 AAATAGAAACAGGCTCAGAGAGG + Intergenic
1007735237 6:43978236-43978258 ACAGGGAGACAGACCCAGGGTGG + Intergenic
1008900627 6:56611264-56611286 ATAAGGAAACAGGCTCAGAGAGG - Intronic
1010085836 6:71917078-71917100 ATAGAGAAACAAGCACAGAGAGG - Intronic
1010169278 6:72956221-72956243 TGAAAGAAACAGACTCAGAGAGG + Intronic
1010292035 6:74148398-74148420 ATAAAGAAACAGAAACAGGGAGG - Intergenic
1010294258 6:74177681-74177703 ATGGGGAAACAGACTTAGGGAGG - Intergenic
1010642126 6:78341615-78341637 AGAGAGACACAGAGTGAGGGGGG - Intergenic
1011002600 6:82607733-82607755 TTTAGGAAACAGACTCAGGGAGG + Intergenic
1011585753 6:88923559-88923581 GCAGAGAAACAGACGCAGGGAGG + Intronic
1011708747 6:90029496-90029518 ATAAAGAAACATAAACAGGGAGG - Intronic
1012005009 6:93702924-93702946 ATAGAAAAACAGCCTCTGGTAGG + Intergenic
1012919151 6:105203398-105203420 ATGGAGAAACAGGCTTAGAGTGG - Intergenic
1013560027 6:111294708-111294730 ATAGAGAAAAAGAACCAGAGAGG - Intergenic
1013934978 6:115583100-115583122 ATAGAAAAACAGATTAAGGTAGG - Intergenic
1015250452 6:131121999-131122021 AGAGAGAAATAGAATCAGAGTGG - Intergenic
1015710100 6:136129970-136129992 ACAGAGAAACCCACTCAGGTGGG - Intronic
1015926155 6:138312256-138312278 AGAGACAAACGGCCTCAGGGAGG - Intronic
1017168337 6:151431402-151431424 ATAGACAAACAGACTGGTGGTGG + Intronic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1020070556 7:5224125-5224147 ACAGTGAAACAGAATCAGGCTGG - Intronic
1020808906 7:12827320-12827342 ATAGGAAAACAGACTCAGGGAGG + Intergenic
1020883868 7:13798220-13798242 TTAGAGAAAAAGAATCAGAGTGG + Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021571688 7:22072464-22072486 ACAGAGAGACAGAGACAGGGAGG - Intergenic
1021601372 7:22367302-22367324 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1023749529 7:43358444-43358466 ATCGAGAAAGTGACTCAGGAAGG + Intronic
1024036433 7:45510873-45510895 ATAGACAAACTGACTCAGCCTGG - Intergenic
1024170883 7:46784792-46784814 ATAGACAAACACACTCAGAAAGG + Intergenic
1024819379 7:53309536-53309558 GTAGAGAAACAAACTCAGAGTGG - Intergenic
1025753494 7:64313030-64313052 GTTGAGAAACAGTCTCAGGGAGG - Intronic
1025825836 7:65009720-65009742 ACACAGAAGCAGACTCAGGTGGG + Intergenic
1025898832 7:65727505-65727527 ACACAGAAGCAGACTCAGGCGGG + Intergenic
1026290520 7:69001828-69001850 GTAGAGGAAGATACTCAGGGTGG - Intergenic
1027179061 7:75925054-75925076 ATTGAGAAAAGGACTCTGGGAGG + Intronic
1027353651 7:77336381-77336403 ATTGAGGAACAGACCCAGGATGG - Intronic
1028744366 7:94310487-94310509 ATAGAGAAACAGAGAGAGAGAGG - Intergenic
1029065501 7:97843944-97843966 AAAGTGAATCAGAGTCAGGGTGG + Intergenic
1029936087 7:104425356-104425378 ATAAGAAAACAGACTCAGAGAGG - Intronic
1030089285 7:105843249-105843271 CCAGAGAAACAGAACCAGGGTGG - Intronic
1031683361 7:124702324-124702346 ATAGAGAAGCAGAGGAAGGGAGG + Intergenic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1032114810 7:129107926-129107948 ACACAGAGACAGACACAGGGAGG - Intergenic
1032189154 7:129753238-129753260 ATTGAGAAACTGACCCAGAGAGG - Intronic
1033128897 7:138728610-138728632 AGAACGAAACATACTCAGGGCGG + Intronic
1033280755 7:140004845-140004867 ATCGAGAAACAGCCTCCGGCCGG + Intronic
1033306146 7:140227195-140227217 GTAGGGAAACAGCCACAGGGAGG - Intergenic
1035372435 7:158388023-158388045 CCAGAGAAACAGACTCAGCAGGG - Intronic
1035411355 7:158645308-158645330 ATATAAAAACAGATGCAGGGTGG + Intronic
1037318360 8:17620418-17620440 ATGGAGAAAAAGATACAGGGTGG + Intronic
1038012464 8:23486046-23486068 AGGGAGAAAGAGAGTCAGGGAGG - Intergenic
1038968994 8:32609632-32609654 AGAGAGAGACAGACAGAGGGAGG - Intronic
1039787342 8:40845795-40845817 AAAGAGAGAGAGACTAAGGGTGG + Intronic
1040593099 8:48814413-48814435 ATTGAGGAACTGTCTCAGGGAGG - Intergenic
1041073483 8:54147893-54147915 ATAGAGAAACTGAGTCTGTGTGG + Exonic
1041758634 8:61339870-61339892 ATAGAGAAAGAGAAGGAGGGAGG + Intronic
1041794261 8:61729536-61729558 ATGGAGAAACATGCTCAGAGAGG + Intergenic
1041868174 8:62600622-62600644 ATAGAGAAACAAATGCAGGTGGG - Intronic
1042038665 8:64566861-64566883 AAAAAGAAACAGGCTCAGAGAGG + Intergenic
1042897282 8:73685094-73685116 AGAGAGAAAAAGACTGAAGGAGG - Intronic
1043013453 8:74909008-74909030 ACAGGGAAACAGACTCCAGGAGG + Intergenic
1045248181 8:100461215-100461237 TTAGGGAAACAGACACAGAGAGG - Intergenic
1046039385 8:108883895-108883917 ATGGAGAAACCCACTCATGGTGG - Intergenic
1047531431 8:125680445-125680467 ACAGAGAAACATACCCAGTGAGG + Intergenic
1048297464 8:133225053-133225075 ATAGGGAGACAGGCCCAGGGTGG + Intronic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1048948368 8:139471967-139471989 AGAGAAAAACAGATTCAAGGGGG - Intergenic
1049178320 8:141207210-141207232 ACAGAGAAACAGACACAAGGAGG + Intronic
1049402961 8:142438759-142438781 ATGGAGACAGACACTCAGGGAGG - Intergenic
1049463006 8:142738817-142738839 ATAGGGAAACAGACTAGGGCAGG + Intergenic
1049944233 9:579205-579227 AGAGGGAAGCAGACCCAGGGTGG - Intronic
1051145104 9:14018898-14018920 ATAGAGAAGCAAGCTCAGAGTGG - Intergenic
1051749715 9:20328443-20328465 ATAGAGAAAAAGTCTCAGCTGGG - Intergenic
1052342406 9:27377029-27377051 ACAGTGAAACAGCCTCAGAGAGG - Intronic
1054800686 9:69345420-69345442 AAAGAGAAACAGTCTCAGAGAGG - Intronic
1056004989 9:82259613-82259635 ATAGACAAACAGAGTCAGCTTGG + Intergenic
1057479366 9:95432504-95432526 ATGGGGAAACAAGCTCAGGGGGG - Intergenic
1058627312 9:106948291-106948313 ATTAAGAAACAGACTCAATGGGG + Intronic
1058627913 9:106954299-106954321 AGAGAGAAAGAGAGTGAGGGGGG + Intronic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058816129 9:108684353-108684375 ATGGAGAATGAGACTCAGAGAGG + Intergenic
1059104488 9:111500037-111500059 GTGGAGGAACAGTCTCAGGGTGG + Intergenic
1059256369 9:112934869-112934891 AAAGAGAAACAGTCCCAGGAAGG + Intergenic
1059382934 9:113942445-113942467 ATATCAAAACAGACTCAGGTAGG - Intronic
1059694769 9:116720681-116720703 ATAGAGAAACTGACTATGGAAGG - Intronic
1059699735 9:116763674-116763696 ACAAAGAAACAAACTCAGAGAGG - Intronic
1060000859 9:119957406-119957428 ATAAGGAAACAGATTCAGAGAGG - Intergenic
1060391549 9:123281766-123281788 ATAGAGAAACAGACTCAGTGGGG + Intergenic
1060434137 9:123579071-123579093 ATGGAGAAACAAAAACAGGGGGG + Intronic
1060481923 9:124021395-124021417 ACAGAGAAGCAGACACAGGGTGG - Intronic
1060502509 9:124172282-124172304 AAATAGAAAGAGACACAGGGAGG - Intergenic
1060732226 9:126046085-126046107 ATAGACTAACAGACTGGGGGAGG + Intergenic
1060799986 9:126537837-126537859 ATAGAAAAACAGTCTCAGCTCGG - Intergenic
1060978258 9:127777856-127777878 AAAGAGAAACAGAAACAAGGCGG + Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061485551 9:130918838-130918860 AGAGAGAAACAGACTCAGAAAGG - Intronic
1061655199 9:132084188-132084210 ACAAGGAAACAGATTCAGGGAGG - Intergenic
1062080366 9:134620388-134620410 AGAGAGAAACACACACAGTGGGG + Intergenic
1185538472 X:882885-882907 AGAGAGAAACAGAGACAGAGAGG + Intergenic
1185595835 X:1306255-1306277 ACAGAGAAACAGAGAGAGGGAGG + Intronic
1185613724 X:1407754-1407776 AAAGAGAGACAGAGACAGGGTGG + Intronic
1186403831 X:9284013-9284035 AGAGAAAAACAGACTCAAGAAGG + Intergenic
1186437141 X:9552314-9552336 ACAGAGAAATAGACTGATGGTGG - Intronic
1187665539 X:21605107-21605129 ATAACAAAACAGACTCAGAGAGG + Intronic
1190330439 X:49231932-49231954 ATGGAGAAACTGTGTCAGGGAGG + Intronic
1191256515 X:58281871-58281893 AGAGAGAAACACACCCGGGGTGG + Intergenic
1191765051 X:64689204-64689226 ATAAAGAATCAGGCTCAGGAGGG + Intergenic
1192080246 X:68040809-68040831 ATGGAGAAACATACTGAGGGGGG - Intergenic
1193331981 X:80245088-80245110 AGAGAGAAAGAGACTCATGGAGG - Intergenic
1193792750 X:85835817-85835839 ATAAGGAAATAAACTCAGGGAGG + Intergenic
1193833558 X:86316205-86316227 ATCTAGAAGCAGACACAGGGGGG - Intronic
1194861973 X:99010689-99010711 AGAGAGAAAGAGAGACAGGGAGG + Intergenic
1195009116 X:100718001-100718023 ATGGGGAAACAGACTCAAGGAGG - Intronic
1197680197 X:129374669-129374691 AAAAAGAAACAGATTCAGCGAGG - Intergenic
1197801985 X:130360216-130360238 ATAGAGAAACAAACACAATGAGG - Intronic
1198741192 X:139844829-139844851 ATGGGAAAACAGACTCAGAGAGG - Intronic
1199525510 X:148786927-148786949 ATAGAGAATTAGACTCAGACTGG - Intronic
1199566631 X:149222420-149222442 ATTGAAACAAAGACTCAGGGAGG + Intergenic
1199594361 X:149494810-149494832 ATAGAGAAGAAAACTCAGGGAGG + Intronic
1199937907 X:152595148-152595170 AAGGAGAAACAGACACAGGCAGG - Intergenic
1199967599 X:152832751-152832773 AATGAGAAACAGGCTCAGAGAGG - Intronic
1200136884 X:153879578-153879600 GTAGAGAGACAGACAGAGGGTGG + Intronic
1200227161 X:154424597-154424619 AAAAAGAGACAGACACAGGGAGG - Intergenic