ID: 997858269

View in Genome Browser
Species Human (GRCh38)
Location 5:137392505-137392527
Sequence GATCTCTGGAGTTACAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997858261_997858269 25 Left 997858261 5:137392457-137392479 CCAAGTCTTAGCAAATCTCACTC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 997858269 5:137392505-137392527 GATCTCTGGAGTTACAGTGAAGG 0: 1
1: 0
2: 1
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997858269 Original CRISPR GATCTCTGGAGTTACAGTGA AGG Intronic
901904438 1:12395387-12395409 GATGTCTGCTGTTAAAGTGAGGG - Intronic
902617518 1:17631965-17631987 CAGCTCTGGAGTTACAGAGGTGG - Intronic
904469686 1:30728670-30728692 GATCCCAGGAAATACAGTGAGGG - Intergenic
907779971 1:57558049-57558071 GATCTCTACTGTTAAAGTGAGGG + Intronic
909172398 1:72313956-72313978 GATCACTGGAGTGATGGTGAGGG + Intergenic
911098875 1:94078257-94078279 CATCTTTGGAGTTACAGAGCTGG + Intronic
911531648 1:99050738-99050760 GTTCTCTGGAGTTACAGTTTTGG - Intergenic
912876356 1:113363833-113363855 GACCTCTGGGCTTATAGTGAGGG + Intergenic
916022771 1:160808396-160808418 GACCTCTGCAGTTATAGTAAGGG - Intronic
918267730 1:182861354-182861376 GATTTTTTGACTTACAGTGAAGG + Intronic
918535557 1:185570507-185570529 GTTCTCTGCAGCTTCAGTGAGGG + Intergenic
920203276 1:204273854-204273876 GATCTCTTGAGTGCCATTGAGGG + Intronic
920425264 1:205869970-205869992 AAACTCTGGAGTTGCAGTTATGG + Intergenic
1064119991 10:12610228-12610250 GATCTCCGGAGTCATGGTGATGG + Intronic
1065262492 10:23938048-23938070 GAGCACTGGAGATACAGAGAAGG + Intronic
1069083112 10:64109306-64109328 GATCTGAGGAGTTACAGAGAGGG + Intergenic
1069821893 10:71233549-71233571 CACCTCTGGAGCTAGAGTGATGG - Intronic
1070344776 10:75531121-75531143 GGTCTCTAGGGTTACAGTGGAGG + Intronic
1070670603 10:78374900-78374922 GGACTGGGGAGTTACAGTGAGGG - Intergenic
1071872126 10:89807366-89807388 GATTTATTGACTTACAGTGAGGG + Intergenic
1072209023 10:93229991-93230013 GAAAACTGGAGTTACAGTGTTGG - Intergenic
1073983925 10:109186769-109186791 GATTACTGGAGTTACAGCCATGG + Intergenic
1074019643 10:109569024-109569046 GATCTCTGGATTTATACTAATGG - Intergenic
1076462929 10:130658822-130658844 GGTGTCTGGAGTCACAGAGATGG + Intergenic
1080390731 11:31843718-31843740 GATTTCTGGAGTTACAGATTTGG + Intronic
1080766363 11:35300930-35300952 GATCACTTGAGCTACAGTGAGGG + Intronic
1083467513 11:62858501-62858523 GAGGTCAGGAGTTAGAGTGAAGG + Intronic
1085237167 11:75024043-75024065 GATTTGTGGAATTGCAGTGAAGG - Intergenic
1088571765 11:111229777-111229799 GAACGCTGGAGTTACAGTGTAGG + Intergenic
1090469424 11:126967029-126967051 GCTCTCTGGGCTTACAGAGAAGG - Intronic
1091212120 11:133871070-133871092 GATGTCTGCTGTTAAAGTGAAGG + Intergenic
1091240513 11:134049147-134049169 GATCTGTGGAGTCCCAGGGAGGG + Intergenic
1094478384 12:30860173-30860195 AACCTCTGGAGTTACAGGGGCGG + Intergenic
1095539540 12:43292721-43292743 GGGCTCTGGAGTGACTGTGAAGG + Intergenic
1103409887 12:120703376-120703398 GCTCTAGGGAGTTACAGGGAGGG + Intergenic
1104075000 12:125381118-125381140 GCTCTGTGGAGTTACAGGCACGG + Intronic
1104477949 12:129085511-129085533 GATCTCTGGAGGCAGAATGAGGG - Intronic
1106038933 13:26071123-26071145 GAGCTATGAAGTTAGAGTGATGG - Intergenic
1106865356 13:33958647-33958669 GATGTCTGGAGTTTCAGGTAAGG + Intronic
1107808745 13:44179150-44179172 GAAAGCTGGAGATACAGTGAAGG - Intergenic
1111686774 13:91512147-91512169 GATTTCTGGAGTTGCGATGATGG - Intronic
1112597989 13:100827140-100827162 GAGCACTGGAGTTACAGTTGTGG - Intergenic
1113203401 13:107891056-107891078 CATCTCTGGAGTTCTAGGGATGG - Intergenic
1113214480 13:108022428-108022450 GATGTCTTCACTTACAGTGATGG - Intergenic
1113374938 13:109756358-109756380 AATCTCTGGAGTTCCAGAAAGGG + Intronic
1113474767 13:110572444-110572466 GATCACTGTAGTTAAAGAGACGG + Intergenic
1116409953 14:44609431-44609453 GATCTCTGGAGTTTTATAGAGGG + Intergenic
1117207760 14:53462042-53462064 TATCTCTGGAATTAAGGTGATGG - Intergenic
1117300721 14:54423912-54423934 GATCTTTGGGGTTGGAGTGAAGG - Exonic
1118042206 14:61929583-61929605 GATCCGTGAATTTACAGTGAAGG + Intergenic
1118404377 14:65409375-65409397 GATCTGTGGAGTTCCAGCAAGGG - Intergenic
1118807503 14:69250814-69250836 GATCTCTGGATTCCCAGTAAGGG + Intergenic
1118824140 14:69365201-69365223 GCTTTCTGGAGTTAAAGTGGGGG + Intergenic
1122011241 14:98750751-98750773 GGTCACTGGAGTTAGTGTGAAGG - Intergenic
1128936504 15:71750508-71750530 CATCTCTGGAGGTGGAGTGAAGG - Intronic
1129411160 15:75351045-75351067 GATATGTGGAGTACCAGTGAGGG - Intronic
1130916882 15:88312155-88312177 GATCACTGGGATTAAAGTGAGGG + Intergenic
1131874468 15:96790081-96790103 GGTCTCTGGTGCCACAGTGAAGG + Intergenic
1139312232 16:66037362-66037384 AAACTCTGGAGTTTCTGTGATGG + Intergenic
1140913565 16:79474850-79474872 GATCTCTCCTGATACAGTGATGG - Intergenic
1141324887 16:83047209-83047231 GGCCTCTGGAGTAAGAGTGAGGG - Intronic
1146641837 17:34547612-34547634 GACCTCTGGAGCTGCACTGAGGG + Intergenic
1149384193 17:56125725-56125747 GTGCTGTGGAGTTCCAGTGATGG - Intronic
1151829333 17:76540436-76540458 GACCTGTGGAGGGACAGTGAGGG + Intronic
1153421205 18:4907306-4907328 GATCTCTGGTGTTACTTTCATGG - Intergenic
1156745131 18:40381193-40381215 GAACACTGGAGTCACTGTGATGG - Intergenic
1157936133 18:51874757-51874779 GAGCCCTGGAGATACTGTGAGGG - Intergenic
1162150157 19:8639270-8639292 GATCTCAAGAGTTACAGGCATGG + Intergenic
1162173507 19:8811069-8811091 TATCTCTGTAGTTACACTGCAGG - Exonic
1165335526 19:35167195-35167217 TATCTCTGGAGGTACAGGCAGGG + Intronic
1167026444 19:46922674-46922696 GAGTTCTGGTGTTTCAGTGAAGG - Intronic
925449175 2:3953607-3953629 GGCCTTTGGAGTCACAGTGATGG + Intergenic
925999772 2:9321347-9321369 GAGTTCTGGAGTTTCATTGATGG + Intronic
928049034 2:27969325-27969347 GATCTCTGGAAGCACAGTGAGGG + Intronic
929549832 2:42882993-42883015 GGTCTCTACTGTTACAGTGAGGG + Intergenic
929818381 2:45254442-45254464 GATTTTTGGGGGTACAGTGATGG - Intergenic
929894880 2:45951075-45951097 GAACACTGGCTTTACAGTGATGG - Intronic
930121235 2:47762593-47762615 GATTTCTCTACTTACAGTGAGGG - Intronic
930205504 2:48583656-48583678 GGTCTCTGGAGTTAAATTGGAGG + Intronic
935172775 2:100623554-100623576 GAACTCTGCTGTTACAGAGAGGG + Intergenic
935454480 2:103251269-103251291 GATATCTGGGGTTAAAGGGATGG - Intergenic
936252883 2:110880837-110880859 AATCTCAGGAGTTTCATTGATGG - Intronic
936292850 2:111239724-111239746 GAGATCTGGAGTTAGAGTGGAGG + Intergenic
936302152 2:111312157-111312179 GAGCTTTGGAGTTACAGAGCCGG - Intergenic
940823932 2:158388392-158388414 GAACTCTGGAGCTAGAGTGTGGG + Intronic
948556151 2:238812966-238812988 GTTCTCTGGAGTTGCAGTGGTGG + Intergenic
1170808037 20:19651037-19651059 GATTTCTAGAATGACAGTGAAGG - Intronic
1175538273 20:59730412-59730434 GGGCTCTGGGGTTACAGTGGGGG + Intronic
1175740244 20:61414980-61415002 AATCTTTGGAGTCACCGTGAGGG - Intronic
1176037800 20:63048855-63048877 GGTCTCTGGAGTGACAGGGATGG + Intergenic
1179534427 21:42042166-42042188 GATCTCAGGAAGCACAGTGAAGG - Intergenic
1185413526 22:50697846-50697868 GATCCCTGGTGTCACGGTGAAGG + Intergenic
949634084 3:5963356-5963378 GATATGTGGAGTTACAGAAAGGG + Intergenic
950004637 3:9683928-9683950 AGTCTCTGGAGTTCCAGTAAAGG + Intronic
953701304 3:45198103-45198125 GATCTTTTGATCTACAGTGAGGG + Intergenic
954529271 3:51304267-51304289 GAAGACTGGAGCTACAGTGATGG + Intronic
958465974 3:94459200-94459222 GATCTGTATAGTTACAGTGAGGG + Intergenic
958491269 3:94776878-94776900 AATCTTTGGAGATACAGGGATGG - Intergenic
963700994 3:148626698-148626720 TCTGTCTGGAGATACAGTGAGGG - Intergenic
963727896 3:148942206-148942228 GAGCTCTGGAGTGACAGTGAGGG + Intergenic
966580235 3:181553222-181553244 GAGCTCTGGAGTCACATTGCTGG + Intergenic
967308035 3:188077681-188077703 GAAGACTGGAGTTACAGTGTGGG - Intergenic
969992112 4:11275350-11275372 ATGCTCAGGAGTTACAGTGAGGG + Intergenic
972331296 4:38066709-38066731 GGGCTCTGGGGTTACAGTGATGG + Intronic
973713139 4:53649357-53649379 AATCTCTAGTTTTACAGTGAAGG + Intronic
973975619 4:56259623-56259645 GATCACTGGAGTGATAGTAAAGG - Intronic
980429464 4:132673534-132673556 AATCTATGGCGTTACGGTGAAGG + Intergenic
980851319 4:138386492-138386514 GATTTCTGAACTTCCAGTGAGGG - Intergenic
981712033 4:147718894-147718916 GATCTTTGAAATTACAGTGTAGG - Intergenic
982464243 4:155710534-155710556 GATTTCAGGAGTTCCAGTGGAGG + Exonic
984652046 4:182280832-182280854 GATCTCTTGAATGAGAGTGAAGG + Intronic
985284976 4:188328086-188328108 AATCCCTGTAGTTACAGTCAAGG - Intergenic
986995481 5:13602541-13602563 TCTCTCTGGAGATACAGTGGGGG - Intergenic
987134125 5:14885049-14885071 CTTCTCTGAAGTTACAGTGGTGG + Intergenic
987458604 5:18177970-18177992 GTTCTCTGGAGTTTGGGTGAGGG + Intergenic
990735223 5:58853189-58853211 AATCACAGGAATTACAGTGACGG + Exonic
992017932 5:72594687-72594709 GATCTCAAGAATTACAGTGAGGG - Intergenic
993587535 5:89748969-89748991 TATCTCAAGAGATACAGTGAAGG - Intergenic
993837670 5:92835174-92835196 GCAGGCTGGAGTTACAGTGATGG + Intergenic
994988756 5:106971579-106971601 GATCTCTGGAGTTAATATTAAGG - Intergenic
995477867 5:112565885-112565907 ACTCTCTGGGGTTAGAGTGAGGG + Intergenic
997858269 5:137392505-137392527 GATCTCTGGAGTTACAGTGAAGG + Intronic
998059147 5:139105438-139105460 GATTTCTGCAATTGCAGTGAGGG - Intronic
999613760 5:153399904-153399926 GATCTCTGGGGTCTTAGTGACGG - Intergenic
1001020549 5:168178860-168178882 GACTTCTGGAATTACAGTGCTGG - Intronic
1001739141 5:174035449-174035471 AATCACTGGAGCTATAGTGATGG + Intergenic
1003435133 6:6081149-6081171 TAACTCTGAAGTTACAGTGTTGG + Intergenic
1008660798 6:53665670-53665692 GATCTGTGGAGATAGAGAGAGGG + Exonic
1009974517 6:70658903-70658925 GATCTCTAAGGTGACAGTGAGGG + Intergenic
1011256856 6:85431296-85431318 GCTCTCTGGTGATACAATGATGG - Intergenic
1011388034 6:86818777-86818799 GTTCTCTGCAGTTGCAGCGAGGG - Intergenic
1012075022 6:94672521-94672543 GCTGACTGGAGTCACAGTGATGG - Intergenic
1017561631 6:155634407-155634429 GATCTCTGGAGTTAATGGCAGGG + Intergenic
1020791264 7:12631247-12631269 AATTTCTGGAGATACAGTGGTGG + Intronic
1023576092 7:41628697-41628719 GATCTCTGGATGTAAAGTGGTGG - Intergenic
1024347323 7:48326225-48326247 GGGCTCTGGAGGGACAGTGAAGG - Intronic
1024714071 7:52054543-52054565 GATCACTGGAGACACAGTGCAGG - Intergenic
1028010317 7:85634774-85634796 AATCTCTGTAGTTACAGGGGTGG + Intergenic
1028313442 7:89368749-89368771 GATCTCATGAGTTAAAGTAATGG - Intergenic
1031104494 7:117524339-117524361 GCTCTCTTGAGTTGCAGTCAAGG - Intronic
1032139843 7:129318178-129318200 GATCTCTGAATTTTCAGAGAAGG + Intronic
1032984172 7:137318368-137318390 AATCGCTGGAGTTACAATTAGGG - Intronic
1034485949 7:151362655-151362677 GCTCCCTGGAGTTAAAGAGATGG + Intronic
1039218835 8:35305340-35305362 AATCTCTGGACTTAAAGGGAAGG - Intronic
1039609097 8:38904763-38904785 GCTCACTGGAGTTAGAGGGATGG + Intronic
1041433404 8:57809777-57809799 CAGCTCTGGAGTAAGAGTGAGGG + Intergenic
1042735278 8:71980814-71980836 TAACTCTGGAGTTAAAGTGCAGG + Intronic
1042979907 8:74514797-74514819 GATATCTGCAGTGACAATGAGGG - Intergenic
1043652539 8:82614360-82614382 GTTCTCTGGAGGTTCAGTGAGGG + Intergenic
1043716462 8:83493177-83493199 TCACTTTGGAGTTACAGTGATGG + Intergenic
1044518106 8:93163352-93163374 GTTCTCTAGAGTAGCAGTGAAGG - Intronic
1046666484 8:117009291-117009313 GATTTCTGGAGTTCCAGAAAAGG - Intronic
1047395945 8:124499052-124499074 GAGCTCAGGAGTTCAAGTGATGG - Intronic
1049731076 8:144178861-144178883 GCTCTTTGGATTTACAGTGGAGG + Intronic
1051046270 9:12878250-12878272 TATCTCTGTATCTACAGTGAAGG + Intergenic
1051437594 9:17049346-17049368 CATCTCAGCAGTGACAGTGATGG + Intergenic
1052245003 9:26323724-26323746 AATCTGTGGATTTAAAGTGAGGG + Intergenic
1054770177 9:69076092-69076114 GCTCTCTGGAATTACAAAGAAGG + Intronic
1055286707 9:74736290-74736312 GAGCTCTGGAGTTGCAATGCCGG - Intronic
1055850769 9:80626904-80626926 CATCTCTGGAGTTAGAATGTGGG - Intergenic
1055991151 9:82107109-82107131 GAACTTTGGGGTTAGAGTGATGG + Intergenic
1057701225 9:97364443-97364465 AATCACTGGAGTTACAATAAAGG - Intronic
1058143202 9:101380325-101380347 GGTCTGGGGAGTAACAGTGAGGG + Intronic
1058637063 9:107047551-107047573 GGCCTCTGGACTTACAGCGAAGG - Intergenic
1061533984 9:131236229-131236251 GGTCTCTGGCATTACAGAGAAGG + Intergenic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1062245260 9:135562750-135562772 GATTTTAGGAGTGACAGTGAAGG + Intronic
1186045946 X:5536795-5536817 GAACTCTGGAGTTTCATTTATGG + Intergenic
1189202089 X:39205170-39205192 GGCCTCTGGAGTTTCAGTAATGG - Intergenic
1189338586 X:40186920-40186942 GATCCCAGGAATCACAGTGAGGG + Intergenic
1189904512 X:45743860-45743882 GATCTCTGGGGCTACTGAGATGG + Intergenic
1195303765 X:103558248-103558270 GACCTCTGAAGACACAGTGAGGG + Intergenic
1195741331 X:108067737-108067759 TATTTATTGAGTTACAGTGATGG + Intronic
1196152062 X:112385925-112385947 GATATCTGGATTTACTGGGAAGG + Intergenic
1196422022 X:115532682-115532704 GAGCTCTGGAGGTGGAGTGATGG - Intergenic
1197768119 X:130072111-130072133 GCTCTCTGGTGTGACAGAGATGG - Intronic
1197833284 X:130668250-130668272 GATCCATGGAATTACAGTGTTGG + Intronic
1199284078 X:146036961-146036983 GCTCTCTGGAGGAACATTGAAGG - Intergenic