ID: 997858774

View in Genome Browser
Species Human (GRCh38)
Location 5:137397209-137397231
Sequence ATGACCCTCTAGAACAGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997858771_997858774 6 Left 997858771 5:137397180-137397202 CCAGAAGTGGGATGCAGGGAGCT 0: 1
1: 1
2: 2
3: 20
4: 212
Right 997858774 5:137397209-137397231 ATGACCCTCTAGAACAGCAATGG 0: 1
1: 0
2: 0
3: 6
4: 106
997858765_997858774 24 Left 997858765 5:137397162-137397184 CCTTACCAAAGAACTCATCCAGA 0: 1
1: 0
2: 0
3: 13
4: 221
Right 997858774 5:137397209-137397231 ATGACCCTCTAGAACAGCAATGG 0: 1
1: 0
2: 0
3: 6
4: 106
997858766_997858774 19 Left 997858766 5:137397167-137397189 CCAAAGAACTCATCCAGAAGTGG 0: 1
1: 0
2: 3
3: 12
4: 167
Right 997858774 5:137397209-137397231 ATGACCCTCTAGAACAGCAATGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997858774 Original CRISPR ATGACCCTCTAGAACAGCAA TGG Intronic
903822710 1:26115016-26115038 ATATCCCTCTAAAACAGCAGAGG - Intronic
904428230 1:30445520-30445542 ATCACCTTCTGCAACAGCAAGGG + Intergenic
905467119 1:38163515-38163537 AAGACACTCTAGAACAGAGATGG - Intergenic
905648062 1:39638491-39638513 TTGACTCTCTAGAACAGAATTGG - Intronic
906279131 1:44541650-44541672 ATGACCGTCCGGAACAGAAAAGG - Intronic
910290991 1:85600224-85600246 ATAACTCACAAGAACAGCAAGGG - Intergenic
911649179 1:100368009-100368031 ATGACCCTCTTGAACAAAACAGG + Intronic
911677112 1:100671306-100671328 AGGATCCTCTAGAAGAGCACAGG - Intergenic
914904051 1:151729471-151729493 ATGACCCTGCAAAACAGAAATGG - Exonic
923264738 1:232303634-232303656 AGGACCCTCCAGAGCAGGAATGG + Intergenic
1063212451 10:3893297-3893319 GTGACACTGTAAAACAGCAATGG + Intergenic
1063431909 10:5998660-5998682 ATGTCCCTCTAGCATATCAAGGG + Intergenic
1072894790 10:99357668-99357690 ATGACCCTGGAGAACAGCCAAGG - Intronic
1073935363 10:108625035-108625057 GTGACATTATAGAACAGCAAAGG + Intergenic
1075185572 10:120253512-120253534 ATGAGGCTAAAGAACAGCAAAGG - Intergenic
1075285875 10:121185446-121185468 ATGACCCCTGATAACAGCAATGG + Intergenic
1081317643 11:41650419-41650441 CAGAGGCTCTAGAACAGCAAAGG + Intergenic
1084733771 11:71091534-71091556 AGGAGGCTCTGGAACAGCAAGGG - Intronic
1085468911 11:76744288-76744310 ATGACCCTGGAGGACAGCACTGG - Intergenic
1086493645 11:87380501-87380523 GTGACCTTGTAGAACTGCAACGG - Intergenic
1090656652 11:128850990-128851012 AGGACCCTCCACATCAGCAAAGG + Intronic
1091666682 12:2423925-2423947 ATGAGCCCATAGTACAGCAATGG - Intronic
1093757216 12:22866292-22866314 ATGACCCTCTAGGCCTTCAAGGG + Intergenic
1096869685 12:54585535-54585557 ATGACCCTCTAGGTTAGCAGTGG + Intronic
1099328143 12:81245915-81245937 ATTACCCATAAGAACAGCAAAGG - Intronic
1107482963 13:40800349-40800371 ATGAGCCTCCAGCACAGAAAGGG + Intronic
1108852588 13:54751969-54751991 AGGATCCTTTAGAACAGCAGAGG - Intergenic
1109105927 13:58250891-58250913 ATCAACCTCTGCAACAGCAATGG + Intergenic
1112346727 13:98596333-98596355 ATGACCACCTAGAGCAGCAGAGG - Intergenic
1113385318 13:109842899-109842921 ATGAACCTCTAACTCAGCAAGGG - Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1119740374 14:77010183-77010205 ATTTCACTCTAGAACAGCACCGG + Intergenic
1125707838 15:41756234-41756256 ATGACCCAGTAGAAAAGTAATGG + Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1130047026 15:80453540-80453562 ATGAGCTTCTAGAACAGCGGAGG - Intronic
1131795312 15:96010398-96010420 ATGTCCCTCTGGAACTGCAGAGG - Intergenic
1134293209 16:12920829-12920851 ATGGGACTCTAGAACAGAAAAGG - Intronic
1135039028 16:19103555-19103577 ATGACCACATATAACAGCAAAGG - Intergenic
1136674198 16:31885388-31885410 ATGTCCCTCTTTGACAGCAAGGG - Intronic
1138489323 16:57366962-57366984 ATATCCCTCAAGAACAGCACAGG + Intergenic
1151110333 17:71668759-71668781 ATCACCTTCTAGAACAACCAAGG + Intergenic
1151310477 17:73289666-73289688 ATGACCCTCTTGGCCAGCCATGG + Intronic
1152108936 17:78346506-78346528 AGAACCCTCAAGACCAGCAAGGG + Intergenic
1152578798 17:81156981-81157003 AGGAGCCTCTGGGACAGCAACGG + Intronic
1157305997 18:46518168-46518190 ATGACCCTCTACGGCATCAACGG - Exonic
1157512785 18:48290552-48290574 ATGACCCTCAAAAACACCACAGG - Intronic
1164470504 19:28526276-28526298 CTGACTCTCTAGCACAGCTAGGG - Intergenic
926445151 2:12932535-12932557 ATGACCCTCTATCTCAGCAATGG + Intergenic
935110088 2:100085281-100085303 GTGACTCTCTTGGACAGCAAGGG - Intronic
935432872 2:102995566-102995588 ATTACCTTCTAAAACAGAAAGGG - Intergenic
935914372 2:107933552-107933574 ATGCCCCTCTAAAAGATCAAGGG + Intergenic
936124889 2:109779927-109779949 GTGACTCTCTTGGACAGCAAGGG + Intergenic
936219804 2:110591541-110591563 GTGACTCTCTTGGACAGCAAGGG - Intergenic
937740699 2:125349534-125349556 AGAACTCACTAGAACAGCAAGGG + Intergenic
937977422 2:127590014-127590036 CTGACCCTGTAGGCCAGCAAGGG - Intronic
938938622 2:136149176-136149198 ATGACCCACTGGAGCAGCACTGG - Intergenic
943101529 2:183492785-183492807 AGGACCCTCAGGAACAGTAAAGG - Intergenic
945217502 2:207449804-207449826 ATAAACCTGGAGAACAGCAATGG - Intergenic
948801200 2:240434447-240434469 ATGACCCCCATGTACAGCAAGGG - Intergenic
1175498122 20:59429171-59429193 CTGTCCCTCTGGAAAAGCAATGG + Intergenic
1179992237 21:44954093-44954115 AGGACCCTCCAGAACCCCAAGGG - Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1184448555 22:44569265-44569287 ATGAACTTCTAGAACAGACAGGG + Intergenic
953473590 3:43186918-43186940 ATGGCCCTCCAGAACAGGGAGGG - Intergenic
956578766 3:70785502-70785524 ATGGCCCTATATAACGGCAAGGG + Intergenic
963804576 3:149710327-149710349 ATGACCCTTTAGGACAGGCAGGG + Intronic
964302095 3:155300177-155300199 ATAACTCACAAGAACAGCAACGG + Intergenic
965121216 3:164559752-164559774 ATCACCCTCTAAATCAGTAATGG - Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
970687757 4:18587823-18587845 ATGACCCTGGAGATGAGCAAAGG - Intergenic
976893909 4:90084379-90084401 CAGCCCATCTAGAACAGCAAAGG + Intergenic
979553518 4:122018431-122018453 ATGAACTTCTCGATCAGCAAAGG - Intergenic
980688533 4:136261119-136261141 AGGATCCTCCAGCACAGCAATGG - Intergenic
980900274 4:138898463-138898485 ATTAACCTCTACAACACCAAAGG + Intergenic
980988567 4:139718665-139718687 ATGACCCTCAGGAATTGCAAAGG - Exonic
985496094 5:207127-207149 ATGACCCGGGAGAAAAGCAAAGG - Intronic
986095948 5:4554357-4554379 CTGTCCCTCTGGAACAACAACGG + Intergenic
986949389 5:13063498-13063520 ATGAGCCTACAGAAGAGCAAAGG + Intergenic
988466544 5:31497368-31497390 ATGCTCCTCTGGCACAGCAAGGG + Intronic
989461785 5:41708215-41708237 ATAACCCTCTATAAAATCAAGGG - Intergenic
995101660 5:108316197-108316219 ATGACCCTCTAAAACTTCAAAGG + Intronic
995260219 5:110095361-110095383 AAGAGCCTGTAGCACAGCAAAGG - Intergenic
996327173 5:122287920-122287942 GAGACCCTCTAGAATTGCAAGGG + Intergenic
997858774 5:137397209-137397231 ATGACCCTCTAGAACAGCAATGG + Intronic
1000163540 5:158624963-158624985 ATCACTCTCTAGACCATCAAAGG + Intergenic
1003865267 6:10357311-10357333 ATGGCCCTCTCCAACTGCAAGGG + Intergenic
1005369154 6:25112445-25112467 ATGACCCTATAGTTAAGCAAAGG + Intergenic
1008290977 6:49715770-49715792 ATGCCCTTCTAGAAAAGCAAAGG - Intergenic
1010090863 6:71980073-71980095 ATGACTCTGTAGAAGAGCAGAGG - Intronic
1012432758 6:99183227-99183249 ATATCCCTCTAGAACACCAGAGG - Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1025272478 7:57537952-57537974 ATGATTCTCTAAAACTGCAATGG + Intergenic
1027836418 7:83249784-83249806 TAGACCCTCTATAACAGCAAAGG + Intergenic
1028017402 7:85733634-85733656 ATGCCCCCTTATAACAGCAAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1037420329 8:18695002-18695024 AAGACCCTCTAAGACAGGAAGGG + Intronic
1039489677 8:37938092-37938114 ATAACACTCTAAAACAGTAATGG + Intronic
1041786309 8:61638335-61638357 ATGAACCTCTAGAAAATGAAGGG - Exonic
1043637652 8:82406344-82406366 ATGACAAGCTAGAACAGCAGGGG - Intergenic
1045267201 8:100629783-100629805 ATGACTCTTTAGACCAACAAAGG + Intronic
1045923287 8:107557883-107557905 ATGAGCCTACAGAACTGCAAGGG - Intergenic
1048074206 8:131051416-131051438 ATGACCATGTAAAACTGCAAGGG + Intergenic
1049208974 8:141376613-141376635 ATGACCCTCTTCAAAAGCAGAGG - Intergenic
1050113220 9:2237878-2237900 GGGACCATCTAGAACAGGAATGG - Intergenic
1051059565 9:13030474-13030496 TTGAACCTCAACAACAGCAAAGG + Intergenic
1052821440 9:33140718-33140740 ATGAGCCTGTGGAACAGCACTGG - Intronic
1060754314 9:126201351-126201373 ATGACCCACTAGAAGAGCTAAGG + Intergenic
1062207307 9:135344257-135344279 AAGAACCTCAAGAAAAGCAAAGG + Exonic
1186345616 X:8689312-8689334 ATGTCCTTCTAGAGCAACAATGG + Intronic
1195558720 X:106258133-106258155 ATGCCCGTCTAGAATAGCGAAGG + Intergenic
1197226153 X:123959262-123959284 ACGAACTTCTATAACAGCAATGG + Intergenic
1200900204 Y:8423914-8423936 ATGACCCTCTGCAACATCCAAGG + Intergenic
1202191357 Y:22249380-22249402 ATGAACTTCTATTACAGCAAGGG - Intergenic