ID: 997859964

View in Genome Browser
Species Human (GRCh38)
Location 5:137407449-137407471
Sequence CAGCTTGGTGTACCTGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997859954_997859964 20 Left 997859954 5:137407406-137407428 CCTTCCTGAGACACAGGAACCCA 0: 1
1: 0
2: 4
3: 25
4: 345
Right 997859964 5:137407449-137407471 CAGCTTGGTGTACCTGAGAGGGG No data
997859959_997859964 0 Left 997859959 5:137407426-137407448 CCAGGGTTCTTGCAGTCACTCAC 0: 1
1: 0
2: 0
3: 12
4: 179
Right 997859964 5:137407449-137407471 CAGCTTGGTGTACCTGAGAGGGG No data
997859958_997859964 1 Left 997859958 5:137407425-137407447 CCCAGGGTTCTTGCAGTCACTCA 0: 1
1: 0
2: 0
3: 16
4: 133
Right 997859964 5:137407449-137407471 CAGCTTGGTGTACCTGAGAGGGG No data
997859957_997859964 16 Left 997859957 5:137407410-137407432 CCTGAGACACAGGAACCCAGGGT 0: 1
1: 0
2: 1
3: 25
4: 277
Right 997859964 5:137407449-137407471 CAGCTTGGTGTACCTGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997859964 Original CRISPR CAGCTTGGTGTACCTGAGAG GGG Intronic
No off target data available for this crispr