ID: 997860513

View in Genome Browser
Species Human (GRCh38)
Location 5:137411285-137411307
Sequence AATTATCCACAGAATGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997860504_997860513 22 Left 997860504 5:137411240-137411262 CCCAGATAAAGGGAGCTCTGAGC 0: 1
1: 0
2: 0
3: 13
4: 132
Right 997860513 5:137411285-137411307 AATTATCCACAGAATGAGGACGG 0: 1
1: 0
2: 0
3: 25
4: 246
997860510_997860513 -6 Left 997860510 5:137411268-137411290 CCTATAGGATGGGACCTAATTAT 0: 1
1: 0
2: 1
3: 4
4: 100
Right 997860513 5:137411285-137411307 AATTATCCACAGAATGAGGACGG 0: 1
1: 0
2: 0
3: 25
4: 246
997860505_997860513 21 Left 997860505 5:137411241-137411263 CCAGATAAAGGGAGCTCTGAGCT 0: 1
1: 0
2: 0
3: 14
4: 144
Right 997860513 5:137411285-137411307 AATTATCCACAGAATGAGGACGG 0: 1
1: 0
2: 0
3: 25
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997860513 Original CRISPR AATTATCCACAGAATGAGGA CGG Intronic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
908479059 1:64519015-64519037 AATAATTAACATAATGAGGAAGG - Intronic
908588753 1:65605221-65605243 ACATACCCACAGAATCAGGAAGG - Exonic
912578281 1:110695658-110695680 AATTATTTTCAGAATGGGGATGG - Intergenic
916963765 1:169914528-169914550 ACATATCTTCAGAATGAGGAAGG - Intergenic
917316832 1:173734626-173734648 AATAATCCACATAATCAGGAAGG - Intronic
919103377 1:193121235-193121257 CATCATCCAAAGAATGAAGAGGG + Intergenic
919240570 1:194910968-194910990 AAGTATTGACAGAAGGAGGAAGG - Intergenic
919560331 1:199110234-199110256 CATTATTTAAAGAATGAGGATGG + Intergenic
920562810 1:206951078-206951100 GATTCTCCACTGAATGATGAAGG + Intergenic
920925204 1:210334589-210334611 TATTACCCACAGAAGGAGCAGGG - Intronic
921320392 1:213932855-213932877 AAAGATCCAAAGAAGGAGGATGG - Intergenic
924019325 1:239764327-239764349 AATTATCCTTGGCATGAGGAAGG + Intronic
1063719765 10:8568127-8568149 AAGTATTCACAGAATGTGCATGG - Intergenic
1063748066 10:8908846-8908868 AAATATGGAAAGAATGAGGAAGG - Intergenic
1064554816 10:16537781-16537803 AATAAACCCCAGAATGAGGCAGG - Intergenic
1067232616 10:44422732-44422754 AATTCTCAACAGAAAGAGGAGGG - Intergenic
1068095930 10:52491364-52491386 AATTACCCACATCATAAGGAAGG - Intergenic
1069295647 10:66841143-66841165 AATTAACCACATAATGAAAAAGG + Intronic
1072256883 10:93629610-93629632 ATTTTTCCACAGAATGAGGGTGG + Intronic
1073245228 10:102085738-102085760 CATTATCCTCAGAAGGAGGAGGG + Intergenic
1074271759 10:111960904-111960926 AATCATCAACAAAATGAGGTGGG + Intergenic
1074587476 10:114782394-114782416 AACTACCCACAGAAAGAGCAAGG + Intergenic
1074910334 10:117902797-117902819 CTTTATCCACAGCATGAAGATGG - Intergenic
1074961873 10:118454167-118454189 AATTAAACACAGATTGAGGCAGG - Intergenic
1075231545 10:120684278-120684300 AATTGTCCACAGGCTGAGCAGGG - Intergenic
1075528274 10:123203952-123203974 AAATATTGACAGAATGAGTAAGG + Intergenic
1077616171 11:3675700-3675722 AACTATCCACAGAAGGAAGAGGG - Exonic
1078294225 11:10049923-10049945 AATGAGCCTCAGAATCAGGAAGG + Intronic
1080684909 11:34507177-34507199 AATTCTTCACAGATTTAGGAAGG - Intronic
1081961380 11:47140173-47140195 AATTATCCACTGAATAATGAGGG - Intronic
1082640560 11:55654860-55654882 AACTATCTACACGATGAGGATGG - Intergenic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1085878018 11:80432219-80432241 AATTATGCAAACAATGAGAAGGG - Intergenic
1087141907 11:94772374-94772396 ATTTAGCAACAGAGTGAGGATGG - Intronic
1087301634 11:96443009-96443031 TCTTATCCAGAGGATGAGGATGG + Intronic
1087765798 11:102151880-102151902 AATTATGTACAGAGTGAGGGAGG + Intronic
1088213005 11:107476691-107476713 AATTATCCACAGTAACGGGAGGG + Intergenic
1088744389 11:112793383-112793405 CATTACAGACAGAATGAGGATGG + Intergenic
1088866160 11:113849999-113850021 AATTAACAAAAGAATGGGGAAGG - Intronic
1091090868 11:132770347-132770369 AATTGTCTCCAGAATAAGGAAGG + Intronic
1092461146 12:8687417-8687439 AAGTGACCACAGAAGGAGGATGG - Intronic
1093984230 12:25511059-25511081 AATTATCCATGAAAAGAGGAGGG + Intronic
1094484131 12:30910734-30910756 AGTCATCCACAGACTAAGGATGG - Intergenic
1095837596 12:46655374-46655396 AATTATTCACAGAAAGCAGAGGG + Intergenic
1099316874 12:81095080-81095102 AGTTATCCAGAGAACCAGGAGGG - Intronic
1102915227 12:116747520-116747542 CATTATCCACAGAGTGAGACGGG - Intronic
1104204940 12:126629938-126629960 ACTAATCAAAAGAATGAGGAAGG - Intergenic
1106134688 13:26965304-26965326 CATTTAACACAGAATGAGGAGGG - Intergenic
1106399241 13:29412586-29412608 AATTATTAAAAGAATAAGGAAGG + Intronic
1106405163 13:29466918-29466940 TATTTTCCACAGGATGTGGAAGG - Intronic
1107711603 13:43156001-43156023 ACTTAACAACAGAATGAGGTGGG - Intergenic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1110231687 13:73173789-73173811 AATTATCTTCAGTATAAGGACGG - Intergenic
1110754239 13:79152749-79152771 ATTTTTCCACAGACTGAGGTGGG - Intergenic
1111818335 13:93183072-93183094 AATTATGCACACTGTGAGGAGGG - Intergenic
1111864061 13:93745675-93745697 AGTTACCCACAGGATCAGGAGGG + Intronic
1112656891 13:101461132-101461154 AAGTTTCCCCAGAATGAGAAAGG + Intronic
1112983561 13:105418125-105418147 AAATATACAAAGGATGAGGAAGG - Intergenic
1113370997 13:109725431-109725453 AATTATCAGCTGAAAGAGGAAGG + Intergenic
1113673666 13:112194031-112194053 GTTTATCTACAAAATGAGGAAGG - Intergenic
1114719294 14:24863033-24863055 AATTATCAACAGAATAAAGAAGG - Intronic
1119504635 14:75161924-75161946 AATGATCCTAAGACTGAGGAAGG + Intronic
1119889000 14:78168571-78168593 ATTTGTCCACAGAATGTGGAAGG - Intergenic
1121507795 14:94489885-94489907 CTCCATCCACAGAATGAGGAGGG + Intronic
1124106420 15:26741864-26741886 AACTCTCCAAAGAGTGAGGAGGG - Intronic
1124204397 15:27704696-27704718 AATCATACACAGCAGGAGGATGG + Intergenic
1124356816 15:29001586-29001608 AATGAACCACATAATGAAGAGGG + Intronic
1125810366 15:42535154-42535176 AGTTATCCAGATAATGATGATGG - Intronic
1127340402 15:58037308-58037330 AATTAACCACACATTTAGGAAGG + Intronic
1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG + Intergenic
1136865964 16:33754058-33754080 CATTTGCCACATAATGAGGAGGG - Intergenic
1203106191 16_KI270728v1_random:1362045-1362067 CATTTGCCACATAATGAGGAGGG + Intergenic
1203127323 16_KI270728v1_random:1600323-1600345 CATTTGCCACATAATGAGGAGGG - Intergenic
1143181965 17:4988934-4988956 AAGTCTCCACAGACTGAAGAAGG - Exonic
1146080661 17:29777529-29777551 CATTATACAAAGAATAAGGATGG + Intronic
1147361289 17:39932237-39932259 TAATATCCACAACATGAGGAGGG - Intergenic
1149438618 17:56655820-56655842 AATTATCCAGGGAATGAGGCTGG - Intergenic
1150181602 17:63127194-63127216 ATTTATCCCCAGAATGGAGAAGG - Intronic
1151487242 17:74408676-74408698 AAGTAGCCAGTGAATGAGGATGG - Intergenic
1151954018 17:77371830-77371852 AAATATCCAAAGCATGAGGGAGG + Intronic
1153017148 18:594199-594221 TATAATTCACTGAATGAGGAGGG + Intergenic
1154282723 18:13020468-13020490 AAGTGTCCACAGAAGGATGAGGG - Intronic
1155331632 18:24724845-24724867 ATTTATCCACAGAATGTATATGG - Intergenic
1158778337 18:60615014-60615036 AATGAGCAAGAGAATGAGGAGGG + Intergenic
1158795381 18:60839546-60839568 AGGGAACCACAGAATGAGGATGG + Intergenic
1158804579 18:60954629-60954651 AATTATCCTAAGAATGAAGGAGG + Intergenic
1159373824 18:67565410-67565432 AATTAACCAGAGAAAGAGGAAGG + Intergenic
1159575858 18:70176381-70176403 AATTATTCACTGAATGAACAAGG + Intronic
1161028510 19:2047517-2047539 GCTTGTCCACAGAATGGGGACGG + Intronic
1161504947 19:4639052-4639074 AACTAGCCCCAGAAGGAGGAAGG + Intergenic
1163929184 19:20372308-20372330 AAGTACTTACAGAATGAGGAAGG + Intergenic
1165650971 19:37489714-37489736 AAATATCAACAGAAACAGGATGG + Intergenic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
927228063 2:20789876-20789898 ATTTTTCCACAGACTGGGGAGGG - Intronic
927690968 2:25207876-25207898 AACGATCCATAGAATGAGCATGG + Intergenic
928235305 2:29534129-29534151 TATTATCCACAAAATGAAGCTGG - Intronic
928954689 2:36851974-36851996 AATTATACACACAATGAGACAGG + Intronic
929174636 2:38963884-38963906 ATTTTTCCACAGACTGCGGAGGG + Intronic
930347141 2:50198022-50198044 AATTAAACATAGAATAAGGAGGG - Intronic
932113340 2:69021947-69021969 AAGTATGCAGAGAATGGGGAAGG - Intronic
932599666 2:73114791-73114813 AAGTTTCCACAGACTGAGGGTGG - Intronic
933211649 2:79577239-79577261 ATTTATTCACAGAATGAAGAAGG - Intronic
933342400 2:81039461-81039483 AAGTACCTACAGAATCAGGAAGG + Intergenic
933379520 2:81525124-81525146 AATTATTCTGAGAAGGAGGATGG - Intergenic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
935832145 2:107011363-107011385 AATGATGCACACAATGATGATGG + Intergenic
936083126 2:109448774-109448796 ATTTTTCCACAGACTGAGGCAGG - Intronic
936921608 2:117694897-117694919 AACTTTCCAGAGAATAAGGAAGG - Intergenic
937229184 2:120387496-120387518 AATTCTCCACAGAGTCATGATGG + Intergenic
938509273 2:131923558-131923580 AATCAACCGCAAAATGAGGAAGG + Intergenic
938585798 2:132689248-132689270 ATTCATCCACAGAAGGATGAAGG + Intronic
939186319 2:138865127-138865149 TATTATCCACAGGATGAAGTGGG - Intergenic
939825040 2:147003944-147003966 AAATATGTACAGAATGATGATGG - Intergenic
940486674 2:154304577-154304599 AATTTTCCACTGAATGAAAAAGG + Intronic
941251385 2:163169054-163169076 TTTTATCCACAGAATGAGAAGGG - Intergenic
942403160 2:175624756-175624778 AAGAATCCACAGACTGATGAGGG + Intergenic
944467930 2:200022618-200022640 ATTTACCCAAAGAAAGAGGAAGG - Intergenic
945105345 2:206307162-206307184 AATTAGTCACTGAATGAAGAGGG - Exonic
945187214 2:207151374-207151396 AGTTATCCGCAAATTGAGGAGGG + Intronic
946374612 2:219300476-219300498 ACTAATCCACAGAATGGGGCTGG + Intronic
947984673 2:234438140-234438162 AAATAGGCACACAATGAGGAAGG - Intergenic
1170169689 20:13396707-13396729 AAATATCAACAGAATGAGAAAGG + Intronic
1171156521 20:22879515-22879537 AAGTATCCACAGAAAGAGTTAGG + Intergenic
1171262071 20:23742895-23742917 AATTAGCCACAGAATTATAATGG - Intergenic
1172033127 20:31995469-31995491 ACTTATACTCAGAGTGAGGAGGG + Intronic
1172645964 20:36469800-36469822 AATTATTAACAGGGTGAGGAAGG + Intronic
1174896900 20:54459039-54459061 AGGTCTCTACAGAATGAGGAGGG + Intergenic
1176784212 21:13234986-13235008 AATCAACCGCAAAATGAGGAAGG - Intergenic
1176893532 21:14348119-14348141 AATAATCCCCAGAATGAAGAGGG - Intergenic
1177344299 21:19849715-19849737 AATAATCCACAGTATGCTGAGGG - Intergenic
1177982258 21:27928843-27928865 AATCAACCACAAAATGAGGAAGG - Intergenic
1179073032 21:38090690-38090712 AATTACCCCTACAATGAGGATGG + Intronic
1181765700 22:25090343-25090365 AATTCTCCAAAATATGAGGATGG - Intronic
949386508 3:3508428-3508450 AAAAATATACAGAATGAGGAAGG + Intergenic
950692433 3:14670769-14670791 AATTATCCAAAGAATAAGAATGG - Intronic
950886075 3:16364014-16364036 TATTAACCAAAGAATGAGCAAGG + Intronic
951355411 3:21661025-21661047 AATATTTCACAGAATGTGGATGG + Intronic
951404160 3:22273763-22273785 ACTATTCCACAGGATGAGGAGGG + Intronic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
952381909 3:32811988-32812010 CATTCTCCACAGAAAGAGGGGGG - Intergenic
952383998 3:32826078-32826100 ATTTATCTACAGCATGAGGAAGG - Intronic
952814239 3:37433053-37433075 AATTATATACAGAAGAAGGATGG + Intronic
952990741 3:38828998-38829020 ATTAATTCCCAGAATGAGGATGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
956431571 3:69191730-69191752 AATTTTGCACAGTTTGAGGATGG + Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956597498 3:70983907-70983929 AATTCTCCACAGAGTAAGCACGG + Intronic
956690331 3:71872277-71872299 AATTTCTCAAAGAATGAGGATGG - Intergenic
957022718 3:75142456-75142478 AATTGTCCTCAGTCTGAGGAAGG - Intergenic
957563296 3:81853943-81853965 ATATATGCACAGAATGAGTAAGG + Intergenic
957808300 3:85181358-85181380 ACTTATCCCCAACATGAGGATGG - Intronic
957816437 3:85304571-85304593 AATTTTCCACAGGAAAAGGACGG + Intronic
958477625 3:94604864-94604886 AATTATCCATACAATGAGAGTGG - Intergenic
960515977 3:118603243-118603265 AAGTTTCCACAGACTGAGGAAGG - Intergenic
960537666 3:118831010-118831032 AATTATTCTCAGGATGAGGTTGG + Intergenic
962242831 3:133765644-133765666 TATTATCCATAGAATAAGAATGG - Intronic
963262087 3:143203036-143203058 CATTTTCCAGAGAATAAGGATGG - Intergenic
964351547 3:155807999-155808021 AAGTATGCACAGAATGATTAAGG + Intergenic
964972487 3:162578813-162578835 AAGTACTCACAGAATCAGGAAGG + Intergenic
965543656 3:169894135-169894157 CATCATCCACAAAATGAGAATGG + Intergenic
965969971 3:174542865-174542887 AATTATTCTCATAATGAGGCAGG - Intronic
967625733 3:191681634-191681656 AGTTATCCAGAGAGTGAGCAAGG - Intergenic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
969848653 4:9939424-9939446 AATTATCAACAGACTGGAGAAGG + Intronic
969963535 4:10971257-10971279 AAATATACACAGTATGAGGCAGG + Intergenic
970025097 4:11615577-11615599 AATTATCCAAAAATTAAGGAGGG + Intergenic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
971214811 4:24653008-24653030 AAATATTCTCAGAATGAGAAGGG + Intergenic
971543703 4:27856854-27856876 AATTATTCACAGAAACAGGGGGG - Intergenic
971589028 4:28443242-28443264 AATTATTGAAGGAATGAGGAGGG + Intergenic
972755171 4:42039245-42039267 AAATATACAGAGAATGAGCATGG - Intronic
972789745 4:42359779-42359801 AATTAACCAAAGAATGATTAAGG + Intergenic
973864829 4:55101975-55101997 CACTATCCGCAGAGTGAGGAAGG - Exonic
974148655 4:57977454-57977476 AATTATTTACAGAATAAGGTAGG + Intergenic
974436864 4:61867789-61867811 AAATATGCACAGTTTGAGGATGG - Intronic
976802789 4:89011146-89011168 AATTATTAAGATAATGAGGATGG - Intronic
980839379 4:138238891-138238913 AATTATTCCCAGACTGAGCATGG - Intronic
981199496 4:141963512-141963534 ATTTATCCCCAGTATGAGGCTGG - Intergenic
981477205 4:145198926-145198948 ACTTAGCCAGAGAAGGAGGAGGG - Intergenic
981796747 4:148604401-148604423 AATTATCATGAGAATGGGGATGG + Intergenic
982966126 4:161910595-161910617 AATTTGCCACAGATTGAGTATGG - Intronic
983167369 4:164494644-164494666 AATTATGTACTGAAAGAGGATGG - Intergenic
984306436 4:177998074-177998096 AATTTTCCACAAAATTATGAAGG + Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
984901265 4:184588727-184588749 ACTAATACACAGAATGTGGATGG - Intergenic
985837146 5:2279963-2279985 AATTATAATCAGAATCAGGAAGG - Intergenic
985977292 5:3430283-3430305 AGTTCTCCACAGAAGGACGATGG + Intergenic
986103804 5:4640621-4640643 AAACGTCCACAGAATGAGGGAGG + Intergenic
986349621 5:6865752-6865774 CATTACCCAGAAAATGAGGAAGG - Intergenic
987623879 5:20371996-20372018 CCTTATCCACTTAATGAGGAAGG + Intronic
988358260 5:30203707-30203729 AATTACTTACAGAATTAGGAAGG + Intergenic
990695227 5:58408935-58408957 TACTATCCTCAGAAAGAGGATGG - Intergenic
991581487 5:68160125-68160147 AAATATCAACACAATGAGAAAGG + Intergenic
991987727 5:72307536-72307558 AATTATCCAAAGCATCGGGATGG + Intronic
993335032 5:86646469-86646491 AAGTATCAACAAAATGAAGAGGG + Intergenic
994365562 5:98913007-98913029 AATTTTCCACAGAATTATAATGG + Intronic
994703999 5:103176869-103176891 AATGATTCTCAGAATGAAGATGG + Intronic
994749276 5:103718775-103718797 AATTAGCCCCAGAAAGAGAAAGG - Intergenic
996045575 5:118869396-118869418 AATAATACAAAGATTGAGGAGGG + Intronic
996306757 5:122055770-122055792 AATTAAAAACACAATGAGGATGG + Intronic
996605489 5:125315780-125315802 TATTAGCCACAGATTGAGGGAGG - Intergenic
997860513 5:137411285-137411307 AATTATCCACAGAATGAGGACGG + Intronic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
999828423 5:155296364-155296386 AATTAGCAAGAGAGTGAGGAAGG - Intergenic
1001722991 5:173871776-173871798 AATTAACCACAGAAAGACCAGGG - Intergenic
1002815934 6:680425-680447 AATTATCCTGAGAATGAGATTGG + Intronic
1004931501 6:20467066-20467088 AATTAACAAGAGAATGATGAAGG - Intronic
1005527498 6:26665321-26665343 AATTTTCCACAGATGGTGGAGGG - Intergenic
1006994036 6:38241174-38241196 AACTCTCCAGAGAATCAGGAAGG + Intronic
1008129199 6:47701318-47701340 AATCATGCACAGAAAGAGGCGGG + Intronic
1009517707 6:64641081-64641103 CATTATCAACAGAATGAAAATGG - Intronic
1010045920 6:71443109-71443131 AAATATCCTCAGAAAGAAGATGG - Intergenic
1011274030 6:85610968-85610990 ACTTATCTACAAAATGAGTATGG - Intronic
1012078426 6:94725422-94725444 AATTCATCACAGAAAGAGGAAGG + Intergenic
1012909615 6:105104298-105104320 AATGTTACACAGAATGTGGAAGG - Intronic
1013465818 6:110416038-110416060 ATTTTTCCACAGACTGGGGATGG + Intergenic
1013977649 6:116095354-116095376 AAGTATTTACAGAATCAGGAAGG + Intergenic
1014768106 6:125430471-125430493 CATTATCTACAGACTGAGGCTGG + Intergenic
1015503381 6:133955512-133955534 AATTTTCCAAATAAAGAGGAGGG - Intronic
1016878911 6:148890661-148890683 AATATTGGACAGAATGAGGACGG - Intronic
1017191277 6:151655398-151655420 AAATATCCACAGAGTGACAAAGG + Intergenic
1017520370 6:155196421-155196443 AATTAGCAACAGAAAGAGAAAGG + Intronic
1017631406 6:156399451-156399473 AAATATCAACACAATGAAGAAGG - Intergenic
1020676665 7:11192058-11192080 AATTCCACACAGAAAGAGGAGGG - Intergenic
1020780264 7:12509057-12509079 ACTTTTCCACAGACTGAGGAAGG - Intergenic
1020795014 7:12668408-12668430 GATTATCTACAGAGTGAGAAAGG + Intergenic
1021356119 7:19654968-19654990 AAGTATGTACAGAATCAGGAAGG - Intergenic
1022247196 7:28571717-28571739 CCTTATCCCCAGAATGAGGATGG + Intronic
1023262247 7:38369882-38369904 AATATTACACAGAATGTGGAGGG + Intergenic
1023790979 7:43753446-43753468 AATTACCCACAGCTTTAGGATGG - Intergenic
1024752731 7:52487303-52487325 AAACATCCACACAATGAGGTGGG - Intergenic
1024782948 7:52873690-52873712 AATTAACCACAGAATGTGTTTGG + Intergenic
1025115511 7:56254763-56254785 ACTTATGAACAGAAGGAGGACGG - Intergenic
1026072425 7:67133941-67133963 TATTTTCCACAGGATGAGGAGGG - Intronic
1026199895 7:68205638-68205660 ACTTATGAACAGAATGAGGACGG - Intergenic
1026704474 7:72678297-72678319 TATTTTCCACAGGATGAGGAGGG + Intronic
1027847709 7:83404106-83404128 AATTATTCACAGCATAAGGGAGG + Intronic
1028971958 7:96869179-96869201 ATTAATACACAGAATGAGGTTGG + Intergenic
1029837782 7:103331251-103331273 AATTATGCACAAAATGAGCCAGG - Intronic
1030399061 7:109025975-109025997 TCTTTTCCACAGAATGATGAAGG + Intergenic
1031622370 7:123950045-123950067 AATTATCTGCACAATGAGCAAGG + Intronic
1031926426 7:127642942-127642964 AATCATCCAAAGACTGAGGCTGG - Intergenic
1033503078 7:141973387-141973409 AATCATCCATAGCATGATGATGG + Exonic
1034298587 7:149995586-149995608 AATTAAGCACAGGATGAGGCTGG + Intergenic
1035937522 8:3858249-3858271 TAAAGTCCACAGAATGAGGATGG + Intronic
1038231165 8:25701826-25701848 AATGACCAACAGAATGAGAAAGG + Intergenic
1041835661 8:62210428-62210450 ATTTTTCCACAGAGTGGGGATGG - Intergenic
1042170954 8:65990255-65990277 AATTATACACTGACTGATGAGGG - Intergenic
1042805709 8:72768847-72768869 AATTTTCAAAAGAATGAGGAGGG - Intronic
1043044625 8:75306101-75306123 AATTGTCCAGAGAATTGGGATGG - Intergenic
1044123050 8:88421999-88422021 AAATATCCATAGAATGAAGCCGG + Intergenic
1045472921 8:102528424-102528446 ATTTATCTACAGAATGGGGTGGG - Intergenic
1051051435 9:12936977-12936999 TATAATACACAGAAAGAGGATGG - Intergenic
1051802132 9:20947007-20947029 AAATGTCCACAGAATGAGACAGG - Intronic
1052270148 9:26619952-26619974 AATTACTCAAAGAATGAGGCAGG + Intergenic
1052721824 9:32180854-32180876 AATAGTACACAGAATGAGGCTGG + Intergenic
1056879804 9:90380307-90380329 ATTTATCTACAGAATGTGGCAGG + Intergenic
1057477615 9:95416294-95416316 AATTATGAACAGAATGTTGATGG - Intergenic
1060824243 9:126678597-126678619 AATTTTCCCCAGGATCAGGATGG - Intronic
1061467589 9:130794143-130794165 ATTTTTCCACAGACTGGGGATGG - Intronic
1186444532 X:9615436-9615458 ACTTTTCACCAGAATGAGGATGG - Intronic
1187157352 X:16733398-16733420 TACCACCCACAGAATGAGGATGG + Intronic
1189627368 X:42913185-42913207 AATCATCCAAAAACTGAGGAGGG + Intergenic
1193652928 X:84160745-84160767 TATTATTCACTGAATGAGAAGGG - Intronic
1195588673 X:106598599-106598621 GATTTTCCACAAATTGAGGAAGG - Intergenic
1197635629 X:128911866-128911888 AATTTACAACAGAATGAAGAGGG + Intergenic
1197947988 X:131861497-131861519 CAGTATCCACAGAGTGATGAAGG + Intergenic
1200306694 X:155032615-155032637 ATTAATCCACAGAATAAGGTAGG - Intronic
1200376510 X:155786504-155786526 AAGTAACCACATAATTAGGAGGG - Intergenic
1201900040 Y:19039808-19039830 AAGTACCTACAGAATCAGGAAGG - Intergenic
1201943977 Y:19490761-19490783 ATTTTTCCACAGACAGAGGAGGG + Intergenic