ID: 997864104

View in Genome Browser
Species Human (GRCh38)
Location 5:137445449-137445471
Sequence CTGGGCACTCAGAGGCAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 392}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997864096_997864104 22 Left 997864096 5:137445404-137445426 CCAGATTGAGAAGAGAAAAAAAA 0: 1
1: 0
2: 15
3: 204
4: 1985
Right 997864104 5:137445449-137445471 CTGGGCACTCAGAGGCAACAGGG 0: 1
1: 0
2: 1
3: 39
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997864104 Original CRISPR CTGGGCACTCAGAGGCAACA GGG Intronic
900134887 1:1112268-1112290 GTGTGCACTGAGAGGCAAAATGG + Intronic
900463442 1:2812248-2812270 CTGGGCACACATGGGCACCAAGG - Intergenic
901448904 1:9324458-9324480 CTGGGCACAGAGAGACACCATGG - Intronic
902330058 1:15726905-15726927 CTGTGCCCTCAGAGGCTACATGG + Intronic
903179171 1:21596945-21596967 CTCTGGACTCAGAGGGAACAAGG - Intronic
903309645 1:22444546-22444568 ATGTGCACTAAGAGGCAAAATGG + Intergenic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
906332347 1:44897070-44897092 CTGGGCAGAAAGAGGCATCATGG + Intronic
906569037 1:46820655-46820677 CTGGCCACTCCGAGTGAACAGGG - Intergenic
907813301 1:57893899-57893921 CTGAGCACTAAGAGGCAAAATGG + Intronic
908752099 1:67433731-67433753 CTGGGCACCCAGTGGTAACACGG + Intergenic
909725350 1:78828324-78828346 CTGGCCCATCAGAGGGAACAGGG + Intergenic
910365443 1:86460246-86460268 ATGTGCACTAAGAGGCAAAATGG - Intergenic
911747166 1:101452739-101452761 CTGTGTACTAAGAGGCAAAATGG + Intergenic
912940145 1:114037539-114037561 ATGTGCACTAAGAGGCAAAATGG - Intergenic
914213731 1:145605932-145605954 CTGGGGACTCAGAGCCCAGATGG + Intergenic
914465674 1:147926337-147926359 CTGGGGACTCAGAGCCCAGATGG + Intergenic
917488182 1:175474346-175474368 CAGGGCATCCAGAGGCACCAGGG + Intronic
918324502 1:183396455-183396477 ATGTGCACTAAGAGGCAAAATGG + Intronic
919739577 1:200973763-200973785 CTGTGCACTCAGAGGCCCCCAGG + Intronic
919926100 1:202192681-202192703 CTGGGACCTCAGAGGCATCCAGG - Intergenic
920347140 1:205313759-205313781 CGGGGCCCTCAGAGGCTGCAGGG + Intronic
920423949 1:205858299-205858321 CTGGGCACTCTGAAGAACCAAGG + Intergenic
920436547 1:205950513-205950535 CAGGGAGCTCAGAGGCAGCAGGG + Intergenic
920798106 1:209160180-209160202 ATGTGCACTAAGAGGCAAAATGG - Intergenic
920862825 1:209724445-209724467 CTGTGCACTTACAGGGAACATGG - Intronic
921797783 1:219367694-219367716 TTAGGCTCTCAGAGTCAACACGG - Intergenic
922334659 1:224608906-224608928 ATGTGCACTAAGAGGCAAAATGG - Intronic
922459025 1:225800653-225800675 CTGGGCGCTCAGAAGAACCAGGG - Intergenic
922760201 1:228124318-228124340 ATGAGCACTAAGAGGCAAAATGG + Intergenic
922875349 1:228936064-228936086 ATGCGCACTAAGAGGCAAAATGG + Intergenic
923079690 1:230641953-230641975 CTGGGAACTCATAGGGAAGAAGG - Intergenic
924154488 1:241162264-241162286 ATGTGCACTAAGAGGCAAAATGG + Intronic
1062788275 10:283311-283333 CTGGGCACGCACAGGCTACTTGG - Exonic
1062986756 10:1776332-1776354 ATGTGCACTAAGAGGCAAAATGG + Intergenic
1063349084 10:5337888-5337910 ATGGGCACTCAGAGGCAATGTGG + Intergenic
1064127307 10:12674428-12674450 GTGGGCACTGAGATACAACAGGG + Intronic
1064404948 10:15053387-15053409 ATGCGCACTAAGAGGCAAAATGG + Intronic
1065127563 10:22588400-22588422 CTTGGTACTAAGATGCAACAGGG - Intronic
1066289361 10:33999694-33999716 ATGCGCACTAAGAGGCAAAATGG - Intergenic
1066504122 10:36024247-36024269 ATGGCCAAGCAGAGGCAACAAGG - Intergenic
1067068199 10:43115306-43115328 CTGAGCACCCAGTGGCCACAGGG + Intronic
1067808421 10:49409013-49409035 CTGGGCACAGAGAGGCAGCTGGG - Intergenic
1068497048 10:57796007-57796029 ATGTGCACTAAGAGGCAAAATGG + Intergenic
1069935527 10:71913140-71913162 ATGCGCACTAAGAGGCAAAATGG - Intergenic
1070816171 10:79324926-79324948 CTGGGGACTCAGAGACTCCAGGG + Intergenic
1071155014 10:82678067-82678089 ATGAGCACTAAGAGGCAAAATGG - Intronic
1071828978 10:89353268-89353290 ATGTGCACTAAGAGGCAAAATGG + Intronic
1072249549 10:93570694-93570716 CTGGGCACCCACAGCCCACATGG - Intronic
1072694777 10:97595074-97595096 CTGGGGACACATAAGCAACATGG - Intronic
1073545517 10:104345212-104345234 CTGAACTCTCATAGGCAACAAGG - Intergenic
1073563326 10:104515486-104515508 CTGGGCACCCAATGGCCACATGG - Intergenic
1073783854 10:106866610-106866632 CAGAGCACTGAGAGGGAACAAGG + Intronic
1074002591 10:109387693-109387715 CTGTGCACTAAGAGACAAAATGG + Intergenic
1074227943 10:111505763-111505785 CTGTGCACTAAGAGACAAAATGG - Intergenic
1075491577 10:122875825-122875847 ATGTGCACTAAGAGGCAAAATGG + Intronic
1075927341 10:126262972-126262994 CTGGGCACTGAGATGCATCCTGG + Intronic
1076881459 10:133241532-133241554 CTGGGCACTCTGGGGCGACATGG - Exonic
1077048715 11:557187-557209 CTGGGTACTGGGAGGCAAGAGGG - Intronic
1077549972 11:3195841-3195863 CTGGGCAGTCAGAGGCAGCCTGG + Intergenic
1077980273 11:7292944-7292966 GTGGGGACTCAGGTGCAACAGGG + Intronic
1078637931 11:13069245-13069267 TTGGGCTCACAGAGGCACCAGGG - Intergenic
1078819356 11:14862059-14862081 ATGTGCACTAAGAGGCAAAATGG - Intronic
1082637625 11:55615644-55615666 CTGAGCAGTCACAGGCAACATGG + Intergenic
1082892963 11:58160003-58160025 CTGGGCCATGAAAGGCAACATGG + Intronic
1083737815 11:64691662-64691684 CCAGGCACTGAGAGGCAAGAAGG + Intronic
1084214604 11:67640556-67640578 CTGGGCATTCAGGGGACACATGG + Intergenic
1084375465 11:68773857-68773879 ATGCGCACTGAGAGGCAAAATGG + Intronic
1084709681 11:70836204-70836226 CTGCACACTCAGAAGCAGCATGG + Intronic
1085053044 11:73389477-73389499 CTGGGCACCAAGAGGAAACTGGG + Intronic
1086737067 11:90320066-90320088 ATGTGCACTGAGAGGCAAAATGG + Intergenic
1088049364 11:105492633-105492655 CTGGGCACCAAAAGGGAACAGGG + Intergenic
1088253576 11:107882365-107882387 ATGCGCACTAAGAGGCAAAATGG + Intronic
1088421510 11:109653319-109653341 CTGGGCACTCAGTGGCTGGAAGG - Intergenic
1089499204 11:118922764-118922786 CTGGGCACCCAGGGGTGACAGGG - Intronic
1089637663 11:119826510-119826532 CTGGGTGCCCAGAGGCAACATGG + Intergenic
1089697509 11:120225181-120225203 CTGGCCAATCAGAAGCACCAAGG + Intronic
1090196868 11:124824039-124824061 CTGCTCACTAAGAGGCAAAATGG + Intergenic
1090806939 11:130208740-130208762 CCGGACACGCAGAGGAAACACGG - Intronic
1091139347 11:133222084-133222106 CTGGGCACACAGTGACTACAGGG - Intronic
1092048910 12:5454151-5454173 CTGGGCCTTCAGATGAAACACGG - Intronic
1093184479 12:16003915-16003937 CTAGCCACTCAGAGGCATCCGGG + Intronic
1095386884 12:41661152-41661174 GTGGGCACTAAGAGGAAACTAGG - Intergenic
1096484610 12:51970209-51970231 CTTGGCACACAGAGCCAGCAGGG - Intronic
1097182854 12:57180831-57180853 CTGGGGGCTCAGGGGCAACAGGG + Intronic
1097307151 12:58081754-58081776 CTGGTGACACAGAGGTAACAAGG + Intergenic
1100135840 12:91552339-91552361 ATGCGCACTAAGAGGCAAAATGG - Intergenic
1100867040 12:98868146-98868168 CTGGACACTCAGAGTCTAGAAGG + Intronic
1101516839 12:105444143-105444165 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1102037112 12:109777334-109777356 CTGGGCAGTGAGAGGTAACGAGG - Intergenic
1102146971 12:110661486-110661508 TTGGCCACTCAGAGCCCACATGG + Intronic
1102802916 12:115752333-115752355 CTGGCCAATCAGAGCCAAAAAGG - Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1107658532 13:42615833-42615855 GTGAGCACTAAGAGGCAAAATGG + Intergenic
1107726405 13:43304082-43304104 CTGGGCACAGGGATGCAACAGGG - Intronic
1108773343 13:53732511-53732533 CTGGGAACAGAGAGGCAAAACGG - Intergenic
1109848154 13:68024489-68024511 ATGCACACTAAGAGGCAACATGG - Intergenic
1109865034 13:68252456-68252478 CTGGGAACTCTTAGGCAGCAGGG - Intergenic
1109952174 13:69512866-69512888 ATGTGCACTAAGAGGCAAAATGG - Intergenic
1111934662 13:94546797-94546819 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1113613075 13:111661769-111661791 CAGGGCACTCGTAGGCCACATGG + Intronic
1116173273 14:41430240-41430262 ATGTGCACTAAGAGGCAAAATGG + Intergenic
1117099761 14:52334259-52334281 ATGTGCACTAAGAGGCAAAATGG - Intergenic
1117410130 14:55442869-55442891 CTGGACACACAGAGACACCAGGG + Intronic
1119597085 14:75944850-75944872 ATGTGCACTAAGAGGCAAAATGG + Intronic
1119822558 14:77630389-77630411 TTGTGCACTAAGAGGCAAAATGG - Intergenic
1120106442 14:80500982-80501004 CTGAGCACTTAGAAGCAAGATGG - Intronic
1121261874 14:92572357-92572379 ATGAGCACTAAGAGGCAAAATGG - Intronic
1121371816 14:93365493-93365515 CTGAGAACTCAGAGTTAACATGG + Intronic
1122642843 14:103170710-103170732 CTGAGCACTCGGAAGAAACAGGG + Intergenic
1122854584 14:104554082-104554104 CTGGGGTGTCAGGGGCAACAGGG + Intronic
1122929167 14:104925622-104925644 CTGGTCAATGAGAGGAAACATGG - Intronic
1126351111 15:47745596-47745618 CTGGGTCCACAGAGGCAAAATGG - Intronic
1126705832 15:51404051-51404073 CTGTGCTAGCAGAGGCAACAGGG - Intronic
1127275709 15:57441832-57441854 CTGGGCTTTCACAGGTAACACGG - Intronic
1127360678 15:58242303-58242325 CGGGGCACACTGAGGCACCAAGG + Intronic
1128701509 15:69807896-69807918 CTGGGCACTCAGTGGCTGCTGGG - Intergenic
1128822331 15:70670174-70670196 ATGCGCACTAAGAGGCAAAATGG + Intronic
1128886036 15:71289196-71289218 CTTGCCCCTCAGAGTCAACAGGG - Intronic
1129050218 15:72774880-72774902 CTGGGAACTCTGATGCAACCTGG + Exonic
1129960189 15:79677257-79677279 CAGGGCCCTCAAAGGCATCAGGG - Intergenic
1129966617 15:79741955-79741977 TTGGGCACTCACAGGTAGCATGG + Intergenic
1130619973 15:85452762-85452784 CAGGACACTGAGAGGGAACATGG - Intronic
1130796184 15:87212108-87212130 CTGTGCAATCACAGGCAACTCGG + Intergenic
1131983224 15:98016402-98016424 GTGGACACTCAGAGGAAACCTGG - Intergenic
1132548395 16:544082-544104 CTCAGCACAGAGAGGCAACAAGG + Intronic
1132561391 16:596067-596089 CTAAGCGCTCACAGGCAACAGGG + Intronic
1133730008 16:8570647-8570669 CTGGACACTCACAGGCCACTGGG - Intronic
1137005499 16:35271717-35271739 TTGGCCACCCAGAGGCCACAGGG + Intergenic
1137746236 16:50822270-50822292 ATGAGCACTTAGAGGCAAAATGG - Intergenic
1137838566 16:51618842-51618864 ATGGCCACTCACAGGCAACTGGG + Intergenic
1138460640 16:57145798-57145820 CAGGGCTCTCAGAGGCCCCAAGG + Intronic
1138615548 16:58162736-58162758 TTGGGGACTCAGGAGCAACATGG - Intronic
1138711015 16:58970391-58970413 ATGTGCACTAAGAGGCAAAATGG - Intergenic
1140068109 16:71626828-71626850 CTGCGCTCTCAGAGGCGACCTGG + Intronic
1140446817 16:75035880-75035902 ATGAGCACTAAGAGGCAAAATGG - Intronic
1141096694 16:81168042-81168064 CTTGGCACTCACTGTCAACAGGG + Intergenic
1141577929 16:84976670-84976692 CTGGGCTCACAGAGGCCACGGGG - Intronic
1142182692 16:88678923-88678945 CTGGCCACTCACAGGCAAGTGGG + Intronic
1143701640 17:8665024-8665046 CTTGTCACAAAGAGGCAACATGG - Intergenic
1146501938 17:33372187-33372209 CTGGGCTCTCAGGGGGATCAGGG + Intronic
1146823375 17:36002291-36002313 ATGTGCACTAAGAGGCAAAATGG - Intergenic
1148026740 17:44593915-44593937 CTGCAAACTCAGAGGCAAAAAGG - Intergenic
1150500324 17:65644306-65644328 CTTGGCACTCAAATGGAACATGG - Intronic
1150814027 17:68378588-68378610 CTGTGGACTCAGAGACAGCAGGG - Intronic
1151453926 17:74215001-74215023 GTGGGCACTCAGGAGCAAGACGG + Intronic
1151864232 17:76789472-76789494 ATGTGCACTAAGAGGCAAAATGG - Intergenic
1151939245 17:77282232-77282254 ATGGGCACACCGAGGCCACAAGG + Intronic
1152059278 17:78057509-78057531 CTGGGCAGTCAGGGTCAGCAAGG + Intronic
1152136510 17:78507027-78507049 GTGGGCACTCCTAGGCAAGAGGG + Intronic
1152153649 17:78618597-78618619 GTGCGCACTAAGAGGCAAAATGG - Intergenic
1152247195 17:79191214-79191236 CTGGGCAAGGAGAGGCCACATGG + Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1153101539 18:1476060-1476082 ATGCGCACTAAGAGGCAAAATGG - Intergenic
1153538884 18:6133841-6133863 CTGTTCACTAAGAGGCAAAATGG + Intronic
1153746053 18:8180732-8180754 ATGTGCACTAAGAGGCAAAATGG - Intronic
1154112921 18:11585792-11585814 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1155252283 18:23964064-23964086 CTGGGGACTCAGAATCACCAGGG - Intergenic
1157312498 18:46562609-46562631 CTGTAGACTCAGAGGCCACAGGG + Intronic
1157816826 18:50735616-50735638 CTAGGCACTAACAGGCATCAAGG - Intergenic
1158094227 18:53752787-53752809 CATGGACCTCAGAGGCAACATGG - Intergenic
1159670737 18:71217737-71217759 ATGTGCACTAAGAGGCAAAATGG - Intergenic
1159864842 18:73691648-73691670 ATGTGCACTAAGAGGCAAAATGG + Intergenic
1159913412 18:74167218-74167240 CTGGGCACACAGAGACACCAGGG + Intergenic
1160327865 18:77967347-77967369 CTGGGCACACAGAGTCACCAAGG + Intergenic
1160553495 18:79711382-79711404 CTGGATACTCAGAGGCAAAAGGG - Intronic
1161061477 19:2217314-2217336 CTGAGAACTAAGAGGCATCAGGG - Intronic
1161796019 19:6387279-6387301 CTGGGGACTCAGGGGTAACCAGG - Intronic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1163924004 19:20321589-20321611 CTGGGCACTCAGAAGAACCAGGG - Intergenic
1164863939 19:31588232-31588254 ATGAGCACTAAGAGGCAAAATGG - Intergenic
1165226188 19:34356945-34356967 TTGAGCACTCTCAGGCAACATGG - Intergenic
1165318045 19:35068645-35068667 CTGGGGACTCTGAGAGAACATGG + Intergenic
1165692461 19:37874227-37874249 ATGTGCACTAAGAGGCAAAATGG - Intergenic
1166528348 19:43527044-43527066 CTGGGCACTAGGCGGCAGCAAGG - Intronic
1166718901 19:44986441-44986463 CTCAGCCCTCTGAGGCAACATGG - Exonic
1167293989 19:48638939-48638961 CAGGGCACTGAGGGGCAACAGGG - Exonic
1167299668 19:48671531-48671553 CCAGGCACCCAGAGGCCACAGGG + Intronic
925553023 2:5096541-5096563 ATGCGCACTAAGAGGCAAAATGG - Intergenic
925751958 2:7096932-7096954 ATGCGCACTAAGAGGCAAAATGG - Intergenic
926028263 2:9563604-9563626 CTGGGCCTTCAGAGGGAGCATGG + Intergenic
926104804 2:10143429-10143451 CAGGGCACTCAGCTGGAACAAGG - Intronic
926180996 2:10642821-10642843 CTGGGCCCTCAGTGGGTACAGGG + Intronic
926374174 2:12210193-12210215 ATGAGCACTAAGAGGCAAAATGG + Intergenic
926439670 2:12874797-12874819 ATGCGCACTAAGAGGCAAAATGG - Intergenic
926686426 2:15701902-15701924 ATGTGCACTAAGAGGCAAAATGG - Intronic
927270794 2:21208303-21208325 CAGGTTATTCAGAGGCAACATGG + Intergenic
929810535 2:45185782-45185804 CTAGGCAATCAGATGAAACATGG + Intergenic
930441632 2:51415477-51415499 GTCGGCACTCTCAGGCAACAAGG - Intergenic
931119674 2:59202241-59202263 CTGCACACTCAGAGTCAACCTGG - Intergenic
931230740 2:60372408-60372430 CTGGGCCCTGAGGGGCAACCAGG - Intergenic
931779195 2:65565161-65565183 CTGGGCAACCAGGGGAAACAAGG - Intergenic
931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG + Intergenic
932411916 2:71552679-71552701 CTGGGCCCGCAGGGGCAACCCGG - Intronic
932833617 2:75013577-75013599 CTGGGCACTGACAGGCAGGAGGG + Intergenic
933563095 2:83913587-83913609 CTGCGCACTAAGAGGCAAAATGG + Intergenic
935053641 2:99545805-99545827 ATTGGCACTCCGAGGCAGCAGGG - Intronic
935696225 2:105773209-105773231 CTTGGCACTCACTGGCAAAAAGG - Intronic
936151620 2:110025074-110025096 CTGGGCACTCAGATCCAGCTGGG + Intergenic
936193054 2:110346295-110346317 CTGGGCACTCAGATCCAGCTGGG - Intergenic
937521084 2:122712700-122712722 CAGGACATTGAGAGGCAACATGG + Intergenic
937523188 2:122736289-122736311 ATGTGCACTAAGAGGCAAAATGG + Intergenic
937721264 2:125099718-125099740 TTGTGCACTAAGAGGCAAAATGG + Intergenic
937868867 2:126773404-126773426 CTGGACCCTCACAGGCAAGAGGG + Intergenic
939195066 2:138961529-138961551 ATGTGCACTAAGAGGCAAAATGG - Intergenic
939755611 2:146105517-146105539 ATGTGCACTAAGAGGCAAAATGG - Intergenic
939825818 2:147014544-147014566 CTAGGAACTCAGAGGTTACAGGG - Intergenic
942925351 2:181425711-181425733 ATGTGCACTAAGAGGCAAAATGG + Intergenic
943872678 2:193021537-193021559 CAAGGCACCAAGAGGCAACAAGG - Intergenic
944662830 2:201935394-201935416 ATGTGCACTAAGAGGCAAAATGG - Intergenic
945392006 2:209275922-209275944 ATGTGCACTAAGAGGCAAAATGG + Intergenic
946054177 2:216886562-216886584 ATGAGCTCTCAGAGGCAAAATGG - Intergenic
946755680 2:222944895-222944917 CTGGGCAGTCAGAACCAAAAAGG - Intergenic
947001995 2:225467234-225467256 ATGTGCACTAAGAGGCAAAATGG - Intronic
947360711 2:229342634-229342656 CTGGGAAATCAGGGGAAACAAGG - Intergenic
947818865 2:233057166-233057188 CTGGGCAGTGAGAAGCATCAGGG - Intergenic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
1170285737 20:14706454-14706476 CTTGGAAGTCAGAGGCCACAAGG - Intronic
1170731743 20:18982252-18982274 CTTCGCTCTCAGAGGCAGCAAGG + Intergenic
1171143794 20:22764713-22764735 CTGGGCACCCAGAGACTGCAAGG - Intergenic
1173622155 20:44444995-44445017 CTGAGGACACAGAGGCCACAGGG + Intergenic
1174531627 20:51219146-51219168 CTGGGGACTCAGAAGTAACCTGG - Intergenic
1174541975 20:51296827-51296849 CTTGGCACAGAGAGGCCACACGG - Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175249538 20:57600911-57600933 CTGGGCAGACCTAGGCAACAAGG - Intergenic
1176147244 20:63571053-63571075 CCGGGTCCTCAGAGGCCACATGG + Intronic
1177415797 21:20792143-20792165 ATGTGCACTAAGAAGCAACATGG + Intergenic
1179260187 21:39750995-39751017 CTGGGAACGCAGAGGCCTCAGGG - Intronic
1179337253 21:40468987-40469009 CTGGGCACTGAGTGGCATCTTGG - Intronic
1180940576 22:19657647-19657669 CTGGGCCCTGAGAGTCAACCTGG + Intergenic
1181275452 22:21685059-21685081 CTGTGCACTCAGAGCCATCAGGG - Intronic
1181317403 22:21979468-21979490 CTGGGGACTCAGAGTCCACATGG - Intronic
1182739870 22:32559926-32559948 CTGTGCACTAAGAGGCAAAATGG + Intronic
1183031148 22:35106025-35106047 TTGGGCACCCATAGGCAAAATGG - Intergenic
1183283863 22:36950639-36950661 CTGGGCACACAGTGGGGACAGGG + Intergenic
1183350382 22:37331507-37331529 TTGGGTACTGAGAGGGAACAGGG - Intergenic
1183356889 22:37364447-37364469 GAGGGCACTCAGAGGGGACAGGG + Intergenic
1183417416 22:37690620-37690642 CTGGGCACCCCGAGCCACCATGG - Intronic
1184209923 22:43029385-43029407 GAGGGCACTCAGAGGCAGAAAGG + Intergenic
1185088938 22:48755334-48755356 CTGGGCCCTCTAAGGCAGCAGGG - Intronic
950191073 3:10976532-10976554 CTGGGGACTAAGAGGCATCCAGG - Intergenic
950869542 3:16216820-16216842 ATGTGCACTAAGAGGCAAAATGG - Intronic
952055260 3:29436356-29436378 CAAGGCACTCAGTAGCAACAGGG - Intronic
952859948 3:37804629-37804651 CTGGGGACACAGTGGAAACAAGG - Intronic
952937661 3:38413022-38413044 CTGGGCAGGCAGGGGCAACAGGG - Exonic
953042800 3:39269726-39269748 CTGGGGACTCTGAGACAGCAGGG - Intronic
953194498 3:40719848-40719870 ATGCGCACTAAGAGGCAAAATGG + Intergenic
953259240 3:41321694-41321716 ATGTGCACTAAGAGGCAAAATGG + Intronic
953293652 3:41691104-41691126 ATGTGCACTAAGAGGCAAAATGG + Intronic
953815621 3:46153922-46153944 CTGGGCACTTGGAGGCCTCAGGG - Intergenic
954183444 3:48899080-48899102 ATGGGAGCTCAGAGGAAACATGG - Intergenic
955046931 3:55369558-55369580 CTTGGCACTCAGTGGCCAGAGGG + Intergenic
955293344 3:57713093-57713115 ATGTGCACTAAGAGGCAAAATGG - Intergenic
955608421 3:60731650-60731672 ATGTGCACTAAGAGGCAAAATGG - Intronic
955825290 3:62939702-62939724 ATGTGCACTAAGAGGCAAAATGG + Intergenic
956044569 3:65181634-65181656 CTGGGTATTCCCAGGCAACATGG - Intergenic
957315411 3:78570027-78570049 ATGCGCACTAAGAGGCAAAAGGG - Intergenic
958781544 3:98549415-98549437 TGGGGCACTCAGAGGACACAGGG - Intronic
958929860 3:100197485-100197507 ATGGGCACTAAGAGGCAAAATGG - Intergenic
961394047 3:126573774-126573796 ATGTGCACTAAGAGGCAAAACGG - Intronic
961480956 3:127180429-127180451 ATGTGCACTAAGAGGCAAAATGG + Intergenic
961619825 3:128215276-128215298 TTGAGCACACAGAGGCAACATGG + Intronic
962829611 3:139128554-139128576 CTGGGCACACAGAGACAAATAGG + Intronic
962875854 3:139535632-139535654 CTGGGGTCGCAGAGGCAACAAGG - Intronic
963634032 3:147770790-147770812 CTGGGAGCTGAGCGGCAACAAGG + Intergenic
963684875 3:148420609-148420631 ATGCGCACTAAGAGGCAAAATGG - Intergenic
965089191 3:164141771-164141793 ATGTGCACTAAGAGGCAAAATGG + Intergenic
965784901 3:172325098-172325120 CTGGTCACACACAGGCAGCAGGG - Intronic
966580879 3:181561458-181561480 CTGGGAACTCAGAAGTAATAAGG + Intergenic
967977412 3:195043251-195043273 CTGGGGACTCGGAGGCATCTTGG + Intergenic
968331320 3:197872958-197872980 CTGGGCAGTGAGAGGGAAGATGG + Intronic
968959190 4:3734395-3734417 CTGGGCAGTCACAGGCAAAACGG + Intergenic
969574579 4:8029623-8029645 CTGGGGGCTCAGAGGAACCAGGG + Intronic
969966509 4:11002541-11002563 CTGGGCACTCATAGGTTCCATGG + Intergenic
970337787 4:15069215-15069237 CTGTGCAGCCAGATGCAACAGGG - Exonic
970390832 4:15611395-15611417 CTGGGCACTCAAAGACAATAGGG + Intronic
970488631 4:16549187-16549209 CTGGGCATTCAGATGAAACCAGG - Intronic
970640195 4:18055701-18055723 CTGGGAACACAGGGGCAAGATGG + Intergenic
971105972 4:23524591-23524613 CTGGGAAATCTGAGGCAACTAGG + Intergenic
971477935 4:27089791-27089813 ATGTGCACTAAGAGGCAAAATGG - Intergenic
971764732 4:30815688-30815710 ATGTGCACTAAGAGGCAAAATGG - Intronic
972329863 4:38055022-38055044 ATGCGCATTAAGAGGCAACATGG - Intronic
972622646 4:40763384-40763406 ATGGGCATTCAGAGGAAACTTGG + Intronic
972884513 4:43469312-43469334 CTGAGCACTCAGAAGAACCAGGG + Intergenic
972987102 4:44778029-44778051 ATGTGCACTAAGAGGCAAAATGG + Intergenic
973702564 4:53551456-53551478 ATGCGCACTAAGAGGCAAAATGG + Intronic
974039186 4:56843342-56843364 GTGTGCACTAAGAGGCAAAATGG + Intergenic
974166972 4:58215856-58215878 ATGTGCACTAAGAGGCAAAATGG - Intergenic
975767271 4:77682007-77682029 ATGCGCACTAAGAGGCAAAATGG - Intergenic
977867723 4:102049819-102049841 ATGTGCACTAAGAGGCAAAATGG + Intronic
978208320 4:106105510-106105532 CAGAGCACTGAGAGGGAACATGG + Intronic
979038712 4:115759310-115759332 ATGTGCACTAAGAGGCAAAAAGG + Intergenic
979065250 4:116123255-116123277 ATGTGCACTAAGAGGCAAAATGG - Intergenic
979154101 4:117360608-117360630 ATGCGCACTAAGAGGCAAAATGG - Intergenic
979154182 4:117361297-117361319 ATGCGCACTAAGAGGCAAAATGG + Intergenic
980259690 4:130432604-130432626 ATGTGCACTAAGAGGCAAAATGG + Intergenic
981006509 4:139880458-139880480 CTGGCCACTCAGGGGCAAGGTGG - Intronic
981928748 4:150167814-150167836 ATGTGCACTAAGAGGCAAAATGG + Intronic
982664923 4:158250526-158250548 CTGGGCTCCCACAGGAAACAGGG - Intronic
984086948 4:175325263-175325285 ATGTGCATTCAGAGGCAAAATGG + Intergenic
984113031 4:175643805-175643827 CTGCACACTAAGAGGCAAAATGG + Intronic
985924652 5:3006404-3006426 ATGTGCACTAAGAGGCAAAATGG - Intergenic
987838975 5:23198289-23198311 ATGAGCACTAAGAGGCAAAATGG - Intergenic
989948961 5:50274340-50274362 TAGGGCATTCAGAGGCAAGAAGG + Intergenic
990594155 5:57296265-57296287 ATGTGCACTAAGAGGCAAAATGG + Intergenic
991929937 5:71744325-71744347 ATGCGCACTAAGAGGCAAAATGG + Intergenic
992399078 5:76395160-76395182 ATGTGCACTCTGAGGCAAAATGG + Intergenic
993634261 5:90325659-90325681 CAGAGCACTAAGAGGGAACATGG - Intergenic
994196534 5:96928908-96928930 ATGTGCACTAAGAGGCAAAATGG + Intronic
994196805 5:96931051-96931073 ATGGGCAGCCAGAGGCAACAAGG + Intronic
994281396 5:97907790-97907812 ATGTGCACTAAGAGGCAAAATGG + Intergenic
997065728 5:130556459-130556481 ATGTGCACTAAGAGGCAAAATGG + Intergenic
997389989 5:133506749-133506771 CTGAGCACTGAGAGCCAAGATGG - Intronic
997675928 5:135713394-135713416 CTGAGTTCTCAGAGGCACCAGGG + Intergenic
997864104 5:137445449-137445471 CTGGGCACTCAGAGGCAACAGGG + Intronic
998414870 5:141938778-141938800 CTGGCCCCTAAGAGGCACCAGGG - Exonic
1000089622 5:157919029-157919051 ATGTGCACTAAGAGGCAAAAGGG - Intergenic
1000698713 5:164421776-164421798 CAGAGCACTGAGAGGGAACATGG - Intergenic
1001901721 5:175436529-175436551 GTGGACAGACAGAGGCAACAGGG + Intergenic
1001914269 5:175546711-175546733 ATGCACACTAAGAGGCAACATGG - Intergenic
1002276728 5:178108769-178108791 CTGGCCACTCACAGACAGCATGG + Intergenic
1002401071 5:178991839-178991861 CTGGGGGCTCCGAGGCACCAAGG - Intronic
1002449504 5:179310798-179310820 CTGGGGACGCAGAGGCATCAGGG + Intronic
1002650954 5:180693251-180693273 GTGGCCACACAGAGGCAAAATGG + Intergenic
1003204296 6:3993005-3993027 ATGTGCACTCAAAGGCAAAATGG - Intergenic
1004634658 6:17455210-17455232 ATGAGCACTAAGAGGCAAAATGG + Intronic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006790640 6:36698916-36698938 CTGGTCCCTCAGAGACAGCAAGG - Intronic
1006923018 6:37638590-37638612 CTGGTCTCTCAGTGGCAATAAGG - Exonic
1007833862 6:44659296-44659318 CTGGGCACACAGTGGCGGCAAGG + Intergenic
1009705030 6:67239032-67239054 CAGGGGACTCAGAGGGGACAGGG - Intergenic
1013306256 6:108849083-108849105 CTGGGCACTTCCAGGCAACAGGG + Intronic
1014555124 6:122836506-122836528 ATGTGCACTAAGAGGCAAAACGG + Intergenic
1014831936 6:126112996-126113018 CTGTCCACTCAGATGCAAAAAGG - Intergenic
1015118167 6:129671965-129671987 CTGTGTTCTCAGAGGCAAAATGG - Intronic
1017426927 6:154331666-154331688 ATGTGCACTAAGAGGCAAAATGG + Intronic
1017535899 6:155348318-155348340 CAGGGCATTGAGAGGGAACATGG - Intergenic
1017815927 6:158016757-158016779 CTGGGCACTCAGAGGTACTCAGG + Intronic
1018847949 6:167568070-167568092 CTGGCCACTGAGAGAGAACATGG - Intergenic
1019073305 6:169367209-169367231 CTGGGTACGCAGAGGCACAAAGG - Intergenic
1019558349 7:1643576-1643598 CTGGGGACTCAGAGGGAATGGGG + Intergenic
1020188493 7:5976365-5976387 CTCGGGACACAGAGGTAACAAGG - Intronic
1020294422 7:6748405-6748427 CTCGGGACACAGAGGTAACAAGG + Intergenic
1021347941 7:19550486-19550508 CTGGGGACCCAGTGGCAAAAGGG - Intergenic
1022321389 7:29291178-29291200 ATGCGCACTAAGAGGCAAAATGG - Intronic
1022358852 7:29640813-29640835 TTGGCCACCCAGAGGCCACAGGG + Intergenic
1023085508 7:36566704-36566726 ATGCACACTGAGAGGCAACATGG + Intronic
1023167623 7:37358461-37358483 CTGGGCAATAAGATGCAAGATGG - Intronic
1023853215 7:44162340-44162362 GTGGGCACGCTGATGCAACAGGG + Intronic
1023896658 7:44439428-44439450 CTGGGCACTCAGAGGGCACGTGG - Intronic
1024016804 7:45324742-45324764 ATGTGCACTAAGAGGCAAAATGG + Intergenic
1024165016 7:46722436-46722458 CTGTCCACCCAGAAGCAACATGG + Intronic
1024283467 7:47737820-47737842 CAGGGCAGACAGTGGCAACAGGG + Intronic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1026156048 7:67826740-67826762 ATGTGCACTCAGAGGCAAAATGG + Intergenic
1026274479 7:68864622-68864644 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1026741101 7:72979118-72979140 ATGTGCACTAAGAGGCAACATGG + Intergenic
1026800930 7:73399432-73399454 ATGTGCACTAAGAGGCAACATGG + Intergenic
1027102633 7:75385960-75385982 ATGTGCACTAAGAGGCAACATGG - Intergenic
1029499261 7:100917827-100917849 ATGTGCACTAAGAGGCAACATGG + Intergenic
1032517722 7:132519340-132519362 CTGTGCACTCAGAGGCCATTGGG - Intronic
1032707619 7:134434802-134434824 CAGGGCTCTCAGAGGCCATATGG - Intergenic
1032721436 7:134553475-134553497 TTGGCCACCCAGAGGCCACAGGG - Intronic
1033095284 7:138425182-138425204 ATGAGCACTAAGAGGCAAAATGG - Intergenic
1034674498 7:152882838-152882860 ATGGGCACACAGAGGCAAGACGG - Intergenic
1035289035 7:157825374-157825396 CTGGGACCTCAGAGGCTGCAAGG + Intronic
1036428910 8:8671471-8671493 CTGGGAACACAGGGGCAAGAGGG + Intergenic
1037586236 8:20278230-20278252 ATGCGCACTAAGAGGCAAAATGG + Intronic
1037879911 8:22567560-22567582 CTGGGCAGTGAGAGGAACCAGGG - Intronic
1037915832 8:22772941-22772963 CTGGGCTCTCATAGCTAACAGGG + Intronic
1038233490 8:25728662-25728684 CAGAGCACTGAGAGGGAACATGG - Intergenic
1039079467 8:33721369-33721391 CTGGGCACTCTGGGGCGACGTGG + Intergenic
1039228566 8:35418166-35418188 CTGGGCAGTAAGAGACAAAAAGG - Intronic
1039234632 8:35488496-35488518 CAAGGCCCTCAGAGGCAACCCGG - Intronic
1039395548 8:37222388-37222410 CTGGGCCCACAGGGGGAACAAGG - Intergenic
1041671311 8:60494193-60494215 CTGGGCACTCAGAAGAACCAGGG + Intergenic
1041810498 8:61903132-61903154 ATGTGCACTAAGAGGCAAAATGG - Intergenic
1043280992 8:78465966-78465988 CAGAGCACTGAGAGGGAACATGG + Intergenic
1044239797 8:89875504-89875526 CATGGCACTCAGAGGTACCAGGG + Intergenic
1045400565 8:101812586-101812608 ATGGGAACTGAGAGGCAATAGGG + Intronic
1047779035 8:128096944-128096966 CTGGGGAGGCAGAGGAAACATGG - Intergenic
1049130198 8:140832680-140832702 CTGTGGACAAAGAGGCAACAGGG + Intronic
1050042927 9:1514604-1514626 ATGCACACTAAGAGGCAACATGG - Intergenic
1050103229 9:2140000-2140022 CTTGGCAGTCAGAAGCAAAATGG + Intronic
1052094540 9:24368934-24368956 CAGAGCACTGAGAGGGAACATGG - Intergenic
1052242685 9:26293319-26293341 GTGTGCACTAAGAGGTAACAAGG - Intergenic
1053656511 9:40222571-40222593 CTGGGCACTCTGTGTCCACACGG - Intergenic
1053825802 9:42023031-42023053 ATGCGCACTAAGAGGCAAAATGG + Intronic
1054343762 9:63893823-63893845 CTATGCACTCAGAGGCAATTTGG + Intergenic
1054368614 9:64368793-64368815 CTGGGCACTCTGTGTCCACACGG - Intergenic
1054528105 9:66153714-66153736 CTGGGCACTCTGTGTCCACACGG + Intergenic
1054604761 9:67164362-67164384 ATGCGCACTAAGAGGCAAAATGG - Intergenic
1054676242 9:67858545-67858567 CTGGGCACTCTGTGTCCACACGG - Intergenic
1055058698 9:72047061-72047083 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1056672006 9:88638406-88638428 CTGGGCACTCAGCCTCAAAATGG + Intergenic
1057076333 9:92140140-92140162 CTGGGACCTCAGAGGCATCCAGG - Intergenic
1057333111 9:94134538-94134560 ATGTGCACTAAGAGGCAAAATGG + Intergenic
1057861330 9:98643159-98643181 CTGGGCACTCGGAGGGGAGAGGG + Intronic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058208752 9:102140639-102140661 CTGGGCACTCCCAGGTACCATGG + Intergenic
1058703421 9:107619749-107619771 CTGGGCAGACAGAGGAACCAGGG + Intergenic
1059140014 9:111844272-111844294 CTGGGCTCTCAGAGAGCACATGG - Intergenic
1059999285 9:119943837-119943859 CTGGGCACTCAGGGACTGCAGGG + Intergenic
1060142571 9:121223116-121223138 ATGCGCACTCAGAGGCAAAATGG - Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061247832 9:129410162-129410184 CGGGGCCTTCAGAGGCAGCATGG + Intergenic
1062389456 9:136328091-136328113 CGGGGCACTCAGGGGCATCATGG + Intronic
1062604780 9:137341789-137341811 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604796 9:137341849-137341871 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604808 9:137341895-137341917 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604909 9:137342295-137342317 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604921 9:137342341-137342363 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1186114184 X:6288183-6288205 CTTGGCACTGAGATGAAACATGG + Intergenic
1188141795 X:26559178-26559200 CTGGGCACTCTGGGGCAACATGG - Intergenic
1188898653 X:35700550-35700572 ATGTGCACTAAGAGGCAAAATGG - Intergenic
1189576100 X:42355309-42355331 CTGGACACTTAAAGGAAACATGG - Intergenic
1189986061 X:46554283-46554305 ATGTGCACTAAGAGGCAAAATGG - Intergenic
1190237320 X:48626403-48626425 CTGGAGACTGAGAGGCCACATGG - Intergenic
1190647901 X:52540233-52540255 ATGGGAACTCACAGGCAAAAAGG + Intergenic
1191739737 X:64423990-64424012 ATGTGCACTAAGAGGCAAAATGG + Intergenic
1192442325 X:71183703-71183725 CTTGACAATCAGAGACAACAAGG + Intergenic
1194289950 X:92059444-92059466 CTGAGTACTCAGAAGCAATATGG - Intronic
1194850710 X:98865196-98865218 ATGCGCACTAAGAGGCAAAATGG + Intergenic
1195325808 X:103757486-103757508 ATGTGCACTAAGAGGCAAAATGG - Intergenic
1195998409 X:110755210-110755232 CTGGGCCCAAAGAGGCTACATGG - Intronic
1197809307 X:130427386-130427408 CTTGGAACACAGAGGCAGCATGG + Intergenic
1198110861 X:133501653-133501675 CTGGGAAATCAGAGGCAAGATGG - Intergenic
1198218100 X:134575038-134575060 TTGGGAAATCAGAGGCAAGATGG + Intronic
1198823491 X:140674193-140674215 ATGTGCACTAAGAGGCAAAATGG + Intergenic
1199718465 X:150524766-150524788 CTGGGCAGGGAGAAGCAACAAGG - Intergenic
1200135740 X:153873771-153873793 ATGGAAACTCAGAGGCAGCAGGG - Intronic
1200492937 Y:3850703-3850725 ATGTGCACTAAGAGGCAAAATGG - Intergenic
1200607465 Y:5284019-5284041 CTGAGTACTCAGAAGCAATATGG - Intronic