ID: 997865650

View in Genome Browser
Species Human (GRCh38)
Location 5:137460427-137460449
Sequence TAGGGAACACAGAAGAGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 321}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997865646_997865650 -4 Left 997865646 5:137460408-137460430 CCAGCCTGTTTAATGCACTTAGG 0: 1
1: 0
2: 1
3: 6
4: 58
Right 997865650 5:137460427-137460449 TAGGGAACACAGAAGAGCCAAGG 0: 1
1: 0
2: 2
3: 19
4: 321
997865644_997865650 20 Left 997865644 5:137460384-137460406 CCAGGTCAAGGTACGGGATAAGG 0: 1
1: 0
2: 0
3: 4
4: 46
Right 997865650 5:137460427-137460449 TAGGGAACACAGAAGAGCCAAGG 0: 1
1: 0
2: 2
3: 19
4: 321
997865649_997865650 -8 Left 997865649 5:137460412-137460434 CCTGTTTAATGCACTTAGGGAAC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 997865650 5:137460427-137460449 TAGGGAACACAGAAGAGCCAAGG 0: 1
1: 0
2: 2
3: 19
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997865650 Original CRISPR TAGGGAACACAGAAGAGCCA AGG Intronic
900711192 1:4115502-4115524 CTGGGAACACACAAGAGGCAAGG - Intergenic
900905055 1:5551311-5551333 TAGGGAAAACACCAGAGCCCTGG - Intergenic
901395257 1:8976473-8976495 GAAGGAATTCAGAAGAGCCAGGG - Intergenic
902173173 1:14629540-14629562 GAGGGAGCAAAGAAGAGGCAGGG - Intronic
902696866 1:18146023-18146045 AAGGTCACACAGCAGAGCCAGGG - Intronic
902978057 1:20103527-20103549 TGGGGCGCACAGAGGAGCCACGG - Intergenic
903093874 1:20950187-20950209 TAGGGAAGACAGTAGAGCACAGG + Intronic
903949066 1:26983745-26983767 TAGGGTACAGAGAAGATTCAAGG + Intergenic
904001073 1:27339115-27339137 CAGGGAGCACAGAAGGCCCAGGG + Intergenic
904010697 1:27388525-27388547 TGGTGAAGACAGAAGAGGCAAGG + Intergenic
904607705 1:31707059-31707081 TAGGGAAAAGAAAGGAGCCAAGG - Intergenic
904893300 1:33795283-33795305 TAGGAAACCCAGAAGGGCCAAGG - Intronic
905283916 1:36867146-36867168 TAGGGAACAGAGACTAGCCCCGG - Intronic
905661283 1:39728046-39728068 TGGGGAACCCAGAAGAGAGATGG + Intronic
905753776 1:40489565-40489587 TAGAGAAAGGAGAAGAGCCATGG + Exonic
905960553 1:42038951-42038973 TTGGGATCAGGGAAGAGCCAGGG - Intergenic
906285595 1:44585723-44585745 AAGGTCACACAGCAGAGCCAAGG - Intronic
906488944 1:46252627-46252649 TAGGGAACACAGAAGAAGAATGG + Intronic
907242122 1:53086606-53086628 CAGGGCACACAGAAGGGCCCTGG - Intergenic
908850279 1:68368930-68368952 AAGGTATTACAGAAGAGCCAGGG + Intergenic
909331786 1:74421921-74421943 TAGGGAGGAAAGAAGAGCCCTGG + Intronic
910051504 1:82979267-82979289 TAGGGAACACAGTAGGAGCAAGG - Intergenic
910240181 1:85078137-85078159 GAGTGGACACAGAAGATCCATGG - Intronic
912080465 1:105930422-105930444 TAGAGAACACAGAGAAGTCAGGG + Intergenic
912230085 1:107783303-107783325 TAGGGAACAGAGAAGGGGCCAGG + Intronic
913535692 1:119769873-119769895 TAGGGAACACAGAAAAGAGCTGG + Intergenic
915604894 1:156944284-156944306 TGGGAAAGACAGAAGAGCCCAGG + Intronic
915805480 1:158844407-158844429 TGGGGAGCAAAGATGAGCCATGG - Intronic
916324476 1:163541746-163541768 TGGGGAACACATCATAGCCAAGG - Intergenic
917569480 1:176250428-176250450 TAGAGGACACAGAAGAGCTAGGG - Intergenic
917723821 1:177811498-177811520 GAGGGAACACAGAGGACCCCAGG + Intergenic
918016609 1:180639920-180639942 TAGGGATCACATGAGATCCAGGG - Intronic
921137410 1:212273906-212273928 TATGGGACACAGAAGAGGAAAGG - Intergenic
921848418 1:219908054-219908076 AAAGGAACAGAGAAGAGTCAAGG + Intronic
922596845 1:226820430-226820452 TAGTGAACACAGGAGACCAAGGG - Intergenic
924277681 1:242404849-242404871 CAGGGAACAGATAAGAGGCATGG - Intronic
924368290 1:243319884-243319906 TAGGGAGGAAAGAAGAGCAAAGG - Intronic
1062900016 10:1137064-1137086 CAGGGAACACGGAAGGGCCCGGG - Intergenic
1066343285 10:34557351-34557373 TAGAAAATACAAAAGAGCCAGGG + Intronic
1067435010 10:46270474-46270496 AAAGGAAAAGAGAAGAGCCAAGG - Intergenic
1069924398 10:71838269-71838291 AAGGGAAAACAGAACAGCAAGGG + Intronic
1070666541 10:78349099-78349121 TAGGCTCCACAGAGGAGCCACGG + Intergenic
1070751631 10:78967384-78967406 TAAGAAACACAGAAGAGACCAGG + Intergenic
1070841013 10:79487910-79487932 GAAGGAGCACAGAGGAGCCAGGG - Intergenic
1071479923 10:86057459-86057481 TTAAGAACAGAGAAGAGCCATGG - Intronic
1072090498 10:92122209-92122231 CAGGGAACACCAAAGAGCAAAGG + Intronic
1072244708 10:93532891-93532913 TAGAGAACTCAGAAGAGAAATGG - Intergenic
1074373480 10:112919783-112919805 CAGGAAACACACCAGAGCCAAGG + Intergenic
1074696502 10:116054284-116054306 TAGGGAACTCTGCAGAGCCCCGG + Intergenic
1074774135 10:116754020-116754042 TAGGCAACATAGTAGAGACACGG + Intergenic
1077499021 11:2900775-2900797 GCGGGAACACAGATGAACCAAGG + Intronic
1077551178 11:3200976-3200998 GAGGGGCCTCAGAAGAGCCAAGG - Intergenic
1077728581 11:4703445-4703467 AATGGAACACAGAAGAGCTTCGG - Intergenic
1079882423 11:25944175-25944197 TTGCCAACACAGAAGAGGCAGGG + Intergenic
1080830570 11:35890117-35890139 CAGGGAGCATGGAAGAGCCAGGG + Intergenic
1081533484 11:43981306-43981328 CAGGGAAGTCAGAAGTGCCAGGG - Intergenic
1081621045 11:44619312-44619334 GAGGAACCACAGAACAGCCAGGG - Exonic
1081800063 11:45852360-45852382 AAGGGACCACAGAAGGCCCAAGG + Intronic
1083619048 11:64039977-64039999 AAGGGAAAACAGAAGAGCCAGGG - Intronic
1085535817 11:77216743-77216765 AAAGGCACACAGAAGGGCCACGG - Exonic
1085556431 11:77426876-77426898 TATGAAACACAAAAGAGCCTAGG + Intronic
1086638489 11:89121572-89121594 TAGAGAACCCAGAAAATCCATGG - Intergenic
1087994335 11:104784905-104784927 TGGGGAACATGAAAGAGCCATGG - Intergenic
1089707829 11:120293288-120293310 TAAGGAACAGCTAAGAGCCATGG + Intronic
1090082451 11:123623080-123623102 TTGGGAACACAGAAGCATCAAGG + Intronic
1090647781 11:128779571-128779593 TATGGAACACTTATGAGCCAAGG + Intronic
1091394044 12:142805-142827 TAGGGGACACAGAAAAGGAAGGG - Intronic
1091767287 12:3129972-3129994 GAGGGATCAAAGAAGACCCAGGG - Intronic
1092998790 12:13976577-13976599 TAGGGAAGAGAAAAAAGCCAGGG - Intronic
1095790388 12:46160951-46160973 TAGGGAATTCAGAAGAGCTAGGG + Intergenic
1095811183 12:46373973-46373995 TAGGGAACACAGGAGTGTGATGG - Intergenic
1096293833 12:50366231-50366253 TCAGGAACACAGGTGAGCCAAGG + Intronic
1096532188 12:52249126-52249148 GAGGAAGCCCAGAAGAGCCACGG + Intronic
1097756820 12:63416104-63416126 TAGGGAAAGGAGAAGAGCCTGGG - Intergenic
1098835331 12:75417663-75417685 TAAAGAATAGAGAAGAGCCAAGG + Intronic
1100015831 12:90009904-90009926 GAAGGAACACAGAAGAGGCGAGG + Intergenic
1100193926 12:92222550-92222572 TATGGAAAACAGAACAGGCAGGG + Intergenic
1100411613 12:94324966-94324988 GAGGGAACACAGGAGGCCCAGGG - Intronic
1101040839 12:100753893-100753915 CAGGGAACACAGAAGTGGCTTGG - Intronic
1102615770 12:114152750-114152772 AAGGGAAGACAGAAGGGCTAGGG + Intergenic
1103894889 12:124266469-124266491 TTGGGAACACAGGTGAGACACGG + Intronic
1104034213 12:125087287-125087309 CAGGGAACAAAGGAGAGCCCCGG - Intronic
1104390667 12:128388437-128388459 GAGGGAAGAGAGAAGAGACAAGG - Intronic
1104943480 12:132405432-132405454 CTGGGAACCCAGGAGAGCCAGGG - Intergenic
1106525472 13:30536987-30537009 CAGGGAAGACAGAGGACCCATGG - Intronic
1107867811 13:44719941-44719963 TAGGGAATTCAGGAGATCCAAGG - Intergenic
1108481335 13:50875327-50875349 CTGGGAACTCAGGAGAGCCAAGG + Intergenic
1111039649 13:82730056-82730078 TAGGGAAAACATAAGATACAGGG - Intergenic
1112746189 13:102530008-102530030 TAGGGAACACAAAGCTGCCATGG + Intergenic
1114818638 14:25989582-25989604 CAGGGCACACAGCAAAGCCAAGG - Intergenic
1116712964 14:48392310-48392332 TAGGGAAGACAGCAGAGAGAAGG - Intergenic
1116865736 14:50030117-50030139 TAGGGAACAAAGGAGAGTAAAGG - Intergenic
1117147817 14:52852696-52852718 TTTGGAAAACAGAAGAGCAAGGG - Intergenic
1119212836 14:72845678-72845700 CTGGGACCACAGAAGAGACAGGG + Intronic
1119872226 14:78027726-78027748 GAGGGACCCAAGAAGAGCCAGGG + Intergenic
1119892492 14:78193425-78193447 TAGGAAACACAGGCTAGCCAGGG + Intergenic
1120038313 14:79723665-79723687 AAAGGAACACAGAAGACCCTGGG - Intronic
1121067288 14:90980274-90980296 TAAGGAACACAGAAGTTTCAGGG - Intronic
1121604163 14:95228192-95228214 TGGGGGACACACTAGAGCCATGG - Intronic
1123474195 15:20577265-20577287 TATGGAACACAGAACACCAAAGG + Intergenic
1123643816 15:22423088-22423110 TATGGAACACAGAACACCAAAGG - Intergenic
1123734496 15:23172277-23172299 TATGGAACACAGAACACCAAAGG + Intergenic
1124285002 15:28393585-28393607 TATGGAACACAGAACACCAAAGG + Intergenic
1124297695 15:28518029-28518051 TATGGAACACAGAACACCAAAGG - Intergenic
1124823579 15:33071312-33071334 TATCTAACACAGAAGAGACACGG + Intronic
1128239924 15:66094866-66094888 TAGGGAAAGCAGAAGATACAAGG - Intronic
1128613773 15:69093838-69093860 GAGGGGACTCAGAAGAGCAAGGG - Intergenic
1128779883 15:70352320-70352342 TAGGGAACAGACTGGAGCCAGGG + Intergenic
1128831855 15:70776777-70776799 TAGGGGACTCAGAAGCGGCAGGG - Intergenic
1128931188 15:71706265-71706287 TAGGGGTAAAAGAAGAGCCAGGG + Intronic
1128939427 15:71775768-71775790 CAAGGAACCAAGAAGAGCCAAGG + Intronic
1128984684 15:72210802-72210824 TAGGGAAAAAAGAACAGCCCTGG - Intronic
1129268627 15:74408148-74408170 TGGGGGACCCAGAAGAGCCCTGG - Intergenic
1130995414 15:88900739-88900761 TAGGAAACAAAAGAGAGCCATGG - Intronic
1131038219 15:89239649-89239671 AAGGGAACACAGAAGCATCAGGG - Intergenic
1131142049 15:89984863-89984885 TAGGAAACACAGCTGGGCCAGGG - Intergenic
1131784900 15:95901922-95901944 TAGGAAAGACAGAAGTGCCCAGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133447411 16:5874000-5874022 GAAGGAACACAGAAGAACCAGGG + Intergenic
1134309653 16:13064008-13064030 GAGTGACAACAGAAGAGCCACGG - Intronic
1135590294 16:23700488-23700510 TCAGGAACAGAGAAAAGCCAGGG - Intronic
1136038642 16:27560603-27560625 CAGGGAACACAGCACAGGCAAGG - Intronic
1138165322 16:54796074-54796096 AAGTGAAAACAGAGGAGCCAGGG + Intergenic
1138908322 16:61365458-61365480 TAGGGAAATCAGAAGAGAAAGGG - Intergenic
1140128489 16:72137412-72137434 TGGGGGAAACAGAAGAGCGAAGG + Intronic
1140212244 16:72979445-72979467 GATGGATCACAGAAGAACCAGGG + Intronic
1141974117 16:87503409-87503431 CAGGGAGCGCAGAAGTGCCAGGG + Intergenic
1143779829 17:9223617-9223639 CAGGGGACACTGAAGACCCAGGG - Intronic
1143787687 17:9268390-9268412 TAGGAAATACACAAGAGCAAAGG + Intronic
1146112671 17:30104704-30104726 TAGGGAACCCAGCAGAGCGCTGG + Intronic
1148543241 17:48496848-48496870 TAGGGAACACTGGGGTGCCAAGG + Intergenic
1148768411 17:50052885-50052907 TAGGGCACAGAGAAGAGGGAAGG + Intergenic
1149238048 17:54616393-54616415 CAGAGAACCCAGACGAGCCAGGG + Intergenic
1150637587 17:66926090-66926112 TAGGGAGCACAGAGAAGCAAAGG + Intergenic
1152022468 17:77787737-77787759 AAGGGCACACAGAAGAGAGAGGG + Intergenic
1152975956 18:218492-218514 AAGGGCAAACAGAAGAACCATGG + Intronic
1153053608 18:924438-924460 AAGGGACCACAGATGAGCAATGG + Intergenic
1153820315 18:8826201-8826223 TGGGGGACACAGCCGAGCCAGGG + Exonic
1155708678 18:28848021-28848043 GAGGAAATACAGAAAAGCCATGG + Intergenic
1155977290 18:32144610-32144632 TATGGAAAACAGAAGTGACAAGG - Intronic
1158958403 18:62565271-62565293 TAGGGAATACAAACCAGCCATGG + Intronic
1159529619 18:69639142-69639164 TAGGAAAAACAGATGAACCAAGG + Intronic
1160064817 18:75564837-75564859 AAGAGAACACAGAAGAAACAAGG - Intergenic
1160314745 18:77831935-77831957 TGGGGAATTCAGAAGAACCAGGG - Intergenic
1160665502 19:326194-326216 TTGGAGACACAGCAGAGCCACGG + Intronic
1160665511 19:326230-326252 TTGGGGACACAGCAGAGCCACGG + Intronic
1160665529 19:326302-326324 TTGGGGACACGGCAGAGCCACGG + Intronic
1160665540 19:326338-326360 TTGGGGACACGGCAGAGCCACGG + Intronic
1160665551 19:326374-326396 TTGGGGACACGGCAGAGCCACGG + Intronic
1161289563 19:3485825-3485847 CAGGGAACCCTGGAGAGCCAAGG - Intergenic
1161960981 19:7522975-7522997 TTGGGAACCCAGCAGAGCCTGGG - Intronic
1163187835 19:15652352-15652374 TAGGGACCAAAGAAAAGGCAAGG + Intronic
1163229478 19:15990510-15990532 TAGGGACAAAAGAAGAGACAAGG - Intergenic
1164808186 19:31133934-31133956 TAGGGGAAAAAGAAGAACCAAGG + Intergenic
1165365604 19:35363058-35363080 GCAGGAACACAGAAGGGCCAGGG - Intergenic
1166945418 19:46393339-46393361 TCGGGAAAACGGAAGGGCCATGG + Intergenic
1167469106 19:49665611-49665633 TAGGTAACGCGGAAGAGCCCGGG - Exonic
1168322918 19:55521121-55521143 AAGGGCACACGGCAGAGCCAGGG + Intergenic
926623562 2:15070513-15070535 TTAGGGACACAGAGGAGCCATGG - Intergenic
927948705 2:27153084-27153106 TAGCTGTCACAGAAGAGCCATGG - Exonic
928955573 2:36863640-36863662 TATGGAAACCCGAAGAGCCAAGG - Intronic
929309472 2:40405757-40405779 AAGGGAAGAAAGAATAGCCAAGG - Intronic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
929887250 2:45889904-45889926 TAAAGAGCACAGAAGAGCGAAGG - Intronic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
933216270 2:79634029-79634051 AAGGGAATACAGAAGACCAATGG + Intronic
933719834 2:85390852-85390874 TTGGGAGCACAGAAGTGCTATGG + Exonic
933966724 2:87435983-87436005 AAGGGGACACAGAAGTGACAAGG - Intergenic
939094246 2:137815405-137815427 TAGGGAACACAGAAAAATTAAGG - Intergenic
940272526 2:151907168-151907190 TAGGGAAAACAGAACAAGCAAGG + Intronic
943457917 2:188130404-188130426 GAGAGAACACAGTAGAGCAATGG - Intergenic
944508990 2:200445841-200445863 AAGGACACACAGAAAAGCCAGGG - Intronic
945741107 2:213662340-213662362 AAGTGAACACAGAATATCCAAGG + Intronic
948191360 2:236061905-236061927 AAAGGAAAACAGATGAGCCAGGG + Intronic
948295186 2:236855366-236855388 GTGGGAGCACAGAAGAGCCCGGG - Intergenic
1170080334 20:12468029-12468051 TAGGGAGAACAGAATTGCCAGGG + Intergenic
1170448027 20:16450465-16450487 AAAGGAGTACAGAAGAGCCAAGG + Intronic
1171066211 20:22017990-22018012 TATGGAACATGGAAGAGCCCGGG + Intergenic
1171235238 20:23519218-23519240 TTGGGGACAGAGAACAGCCAAGG + Intergenic
1173655164 20:44695235-44695257 CAGGGAACCCTGAATAGCCATGG - Intergenic
1174337329 20:49872258-49872280 TAGGGGAAACTGAAGAGCAAAGG + Intronic
1175476474 20:59278510-59278532 TAGGGCACACAGCAAACCCATGG + Intergenic
1175858369 20:62134903-62134925 CAGGGACCACAGAAGGGCCAAGG - Exonic
1176205563 20:63886249-63886271 GAGGGGACACAGAAGGGCCGGGG - Intronic
1178346798 21:31835746-31835768 CAGGAAAGACAGAAGAGCCCAGG - Intergenic
1180886044 22:19244649-19244671 CAGAGAAGACAGAACAGCCAAGG + Intronic
1183258449 22:36778255-36778277 TGGGGAACAGAGAACAGCCCTGG - Intergenic
1183417243 22:37689461-37689483 TAGTGCACACAGACGTGCCAGGG - Intronic
1184683454 22:46085326-46085348 TAGGGAACATAGCAGGGCCTGGG + Intronic
1184729694 22:46365772-46365794 TTGGGAACACAGAAGGGGTAGGG - Intronic
1184924973 22:47630431-47630453 TAGAGAAATCAGCAGAGCCATGG + Intergenic
1185165815 22:49261566-49261588 TAGAGAAGACAAAAGAGCCGAGG + Intergenic
949917770 3:8977713-8977735 TGAGGAACAGAGAAGATCCAGGG - Intergenic
950963668 3:17131082-17131104 TCAAAAACACAGAAGAGCCAAGG + Intergenic
952109851 3:30109612-30109634 TTGGGAACACGGAAGAGCAGAGG - Intergenic
952132002 3:30374684-30374706 GAGGGAACACAGGAGTGGCAGGG + Intergenic
953135585 3:40178978-40179000 TAGGGTACACAGAAGACGCAGGG - Intronic
953351012 3:42216145-42216167 AAGGGGACACAGAAGAGGCTGGG - Intronic
955004308 3:54954801-54954823 GAGGGAACAGAGAAGAGCCAGGG + Intronic
956094805 3:65704497-65704519 TAAGGAACAGAGAAGATCGAGGG - Intronic
957142777 3:76382713-76382735 TAGGAAAGAAAGAACAGCCAGGG + Intronic
958077288 3:88697026-88697048 GAGGGAACAGAGCAGAGCTAGGG - Intergenic
958660808 3:97064000-97064022 TTGTGGACACAGAAGAGACAAGG + Intronic
961555041 3:127691526-127691548 CAGGGGACAGAGAAGAGCCTTGG + Exonic
961957681 3:130821027-130821049 GAGGGAACCTAGAAGTGCCAGGG + Intergenic
962139275 3:132771659-132771681 AAGAGAACACAGAGGAGTCAGGG + Intergenic
962744047 3:138384304-138384326 AACGGAACACAGAGGAACCATGG + Intronic
964196397 3:154069898-154069920 AAAGGAACACACAAAAGCCAAGG + Intergenic
965213760 3:165831555-165831577 AAGGGACCACAGAAAAGACAAGG - Intronic
965925471 3:173973789-173973811 TTGGCTACACAGACGAGCCATGG + Intronic
966814559 3:183879470-183879492 TAGGAAACAGAGACAAGCCATGG + Intronic
966869984 3:184284081-184284103 TGGGGAGCACAGAAAAGCAAGGG - Intronic
968610856 4:1556403-1556425 GAAGGAACACAGAGGTGCCAGGG + Intergenic
968888175 4:3347760-3347782 TAAGGAAAACAGAATAGCTATGG + Intronic
969609912 4:8221239-8221261 AAGGGGTCAGAGAAGAGCCAGGG + Intronic
972337100 4:38116849-38116871 GAGGGAATACATTAGAGCCAAGG + Intronic
973686193 4:53372299-53372321 TGGGGAAGACAGAAAAGTCAAGG + Intergenic
975258893 4:72272790-72272812 TAGGTAGCACAGAAAACCCAGGG + Intergenic
977178274 4:93840921-93840943 CAGGGAACACAGCAGAGGCAGGG + Intergenic
979394309 4:120167867-120167889 AAGAGAACAGAGGAGAGCCATGG + Intergenic
979514596 4:121592905-121592927 TAGGTTACAGATAAGAGCCAGGG - Intergenic
980223728 4:129954032-129954054 TAAGGAAAAGAGAAGAGTCAAGG - Intergenic
981147582 4:141343229-141343251 CAGGGAACACAGATGCTCCAGGG - Intergenic
981663557 4:147195643-147195665 TAGGTGACACAGAAGAGGGAGGG + Intergenic
982266283 4:153541415-153541437 TATGGAAGACACAAGAGTCAGGG + Intronic
982415843 4:155130874-155130896 TATGGAATAGAGAGGAGCCAGGG + Intergenic
984155682 4:176194046-176194068 TAGGCAACACAGAGCAGGCAGGG - Intronic
984886405 4:184453858-184453880 TCAGGAACACAGAAAAGACAAGG + Intronic
986577670 5:9229424-9229446 AAGAGAACACAGGAGGGCCAGGG + Intronic
987362780 5:17121959-17121981 TGTGAAACACAGAAGAGCCGAGG + Intronic
987447113 5:18033730-18033752 TAGGGTAGACAGGAGATCCATGG + Intergenic
988488193 5:31684706-31684728 TGGGTAACAGAGAAGAGGCAAGG - Intronic
989235558 5:39144347-39144369 TAGGAAATACAGAGGAGACAGGG + Intronic
989256233 5:39368538-39368560 AAGGCTACACAGAAGAGGCAGGG + Intronic
990918112 5:60932885-60932907 GAGGGAAGGCAGAAGAGCCTGGG + Intronic
992732545 5:79688041-79688063 GAGGGAAAACAGCAGAGTCAAGG - Intergenic
992744852 5:79809394-79809416 TAAAGAAAAAAGAAGAGCCAGGG - Intergenic
992987010 5:82241159-82241181 TAAGAAAAAGAGAAGAGCCAAGG - Intronic
993494531 5:88593022-88593044 TAGAGGACACAGAAGTGCAAAGG + Intergenic
994294801 5:98078087-98078109 GAGGAGACACAGAAGAGCCATGG + Intergenic
994424490 5:99567789-99567811 TTGGGACCCAAGAAGAGCCAAGG + Intergenic
994514749 5:100756686-100756708 TAGGGACCACTGAAGATCCAAGG - Intergenic
995639170 5:114233835-114233857 TAGGGAACAGAGAAGAAAAATGG - Intergenic
997865650 5:137460427-137460449 TAGGGAACACAGAAGAGCCAAGG + Intronic
998132087 5:139656303-139656325 CAGTGATCACAGCAGAGCCAAGG - Intronic
998418263 5:141960820-141960842 AAGGGAACAGAGAAGAGGGAGGG + Intronic
999641820 5:153680159-153680181 CAGGGAAGACACAAGAGCTATGG + Intronic
1001877776 5:175216255-175216277 TGGGGAAGAGAGACGAGCCAAGG + Intergenic
1006388601 6:33746084-33746106 TAGGGTACCTAGAAGAGTCATGG + Intronic
1006805616 6:36787185-36787207 GAGGGAAGAAGGAAGAGCCATGG - Intronic
1006996767 6:38268331-38268353 AAGGGAACAGGGAGGAGCCATGG - Intronic
1007112240 6:39319566-39319588 TAGGGACCACAGGGAAGCCATGG + Intronic
1007530289 6:42536053-42536075 CAGTGGACACAGAAGACCCATGG - Intergenic
1007625501 6:43243983-43244005 CAGGGATGACAGGAGAGCCAGGG - Intronic
1007724719 6:43908256-43908278 AAGGCCACACAGCAGAGCCAGGG - Intergenic
1008070478 6:47094444-47094466 TGGGGAACAGAGATGACCCATGG - Intergenic
1010085462 6:71912173-71912195 TATAGACCACAGAAGAGGCAGGG - Intronic
1011110964 6:83836337-83836359 TGGGGAAGACTGAAGAGCAAAGG + Intergenic
1011454640 6:87535000-87535022 TAGGAGACACATAAGAGCCTGGG + Intronic
1015605439 6:134950662-134950684 AAAGAAACACAGATGAGCCACGG - Intergenic
1015725786 6:136297981-136298003 TAGAAAATACAGAAGAGCAAAGG - Intergenic
1016356451 6:143224015-143224037 CACGTAACACAGAAGAGGCAGGG - Intronic
1016429073 6:143964139-143964161 TAGGGAACAGAGGGGTGCCAGGG - Intronic
1016446832 6:144141975-144141997 TAGAGACCACAGAAGAGGCCGGG - Intergenic
1017645443 6:156535680-156535702 GAGGGAAGACAGAAGAGAGAAGG + Intergenic
1018985504 6:168633647-168633669 CAGGAGACACAGAAGGGCCAAGG + Intronic
1019567705 7:1692740-1692762 TAGGTCACACAGCAGAGTCAGGG - Intronic
1020361230 7:7328884-7328906 TAGGAGACAAAGAAGAGACATGG + Intergenic
1022287922 7:28973333-28973355 GAGGGAGCACAGAAGGGACAAGG - Intergenic
1023355503 7:39363254-39363276 TAAGGAAAACAGAGGAGTCAAGG + Intronic
1025199062 7:56950646-56950668 TAGGGCAGACAGCAGAGCCCAGG + Intergenic
1025260984 7:57417201-57417223 TAGGGAAGAAAGAACAGACAGGG + Intergenic
1025672885 7:63626287-63626309 TAGGGCAGACAGCAGAGCCCAGG - Intergenic
1027189979 7:75990947-75990969 TGGGGATGACAGAAGAGCCAAGG - Intronic
1029462395 7:100703544-100703566 TAGGGAACTGAGAAGGGCCTGGG + Intergenic
1029510058 7:100988638-100988660 CAGGAAAAACAGAAGAGCTAAGG - Intronic
1029918589 7:104238015-104238037 TAGGGGACATAGATGAGCCAAGG + Intergenic
1030170743 7:106600352-106600374 TAAGGACCACAGTAGATCCAGGG - Intergenic
1031840290 7:126729322-126729344 TAAGCAGGACAGAAGAGCCAAGG + Intronic
1035234582 7:157487974-157487996 GAGGGAACACGGGAGAGCCGGGG + Intergenic
1036497107 8:9279486-9279508 CAGGGACCAGAGAAGAGACAGGG + Intergenic
1036749101 8:11432075-11432097 AAGTGAACACAGATCAGCCAGGG - Intronic
1037754676 8:21703230-21703252 TGGGGAACACAGAAGAAAAAAGG + Intronic
1038655029 8:29442734-29442756 AAAGGAACACTGCAGAGCCATGG + Intergenic
1040457158 8:47610323-47610345 GACGGCACAGAGAAGAGCCATGG + Intronic
1041279406 8:56196041-56196063 TGGGGAGCACAGAAGTGCCATGG + Intronic
1041882680 8:62770228-62770250 TGGAGAGCACAGAAGATCCAGGG + Intronic
1043108453 8:76146953-76146975 TAAGGAAAACAGTAGAGTCAGGG + Intergenic
1044893885 8:96867169-96867191 TAGGGAAAATAGAAGAGCTAGGG - Intronic
1045079727 8:98612563-98612585 TAAGGGACAAAGAAGATCCAGGG - Intronic
1045539778 8:103072767-103072789 AAGGGAACAGAGTAAAGCCATGG + Exonic
1046112241 8:109739095-109739117 TAGGAAACAGAGAAGAGTCACGG - Intergenic
1046289431 8:112137521-112137543 TTGGAAACTAAGAAGAGCCAAGG + Intergenic
1046866417 8:119155861-119155883 CAGGGACAACAGAAGACCCAAGG - Intergenic
1047069314 8:121325047-121325069 TAGAGATCACAGAAGAGTAAAGG + Intergenic
1047218187 8:122896163-122896185 CAGGGAGAACAGAAGAGCAATGG - Intronic
1047622578 8:126622935-126622957 TAGGGAACTCAGAACTCCCATGG + Intergenic
1048037782 8:130693620-130693642 TATGGACCCCAGAACAGCCAAGG - Intergenic
1048403804 8:134097643-134097665 GAGGGAGCAGAGAAGAGTCAGGG + Intergenic
1049344808 8:142133177-142133199 ACGGGAACCCAGAGGAGCCAGGG - Intergenic
1049792107 8:144476864-144476886 TAGGGAACACAGCAGAGAGGTGG - Intergenic
1050052109 9:1613365-1613387 TAGGGAATAAAGAAGAGAGAAGG - Intergenic
1050259065 9:3821946-3821968 AAGTGACCACAGAAGAGTCAGGG - Intergenic
1052819152 9:33125272-33125294 TAAGGAAAAGAGAACAGCCAAGG + Intronic
1055094969 9:72403281-72403303 CAGGGAGCACAGAGGTGCCACGG + Intergenic
1055808577 9:80124875-80124897 AAGGAAAGACAGAGGAGCCATGG - Intergenic
1056238791 9:84622795-84622817 TAGAAAAGACAAAAGAGCCATGG - Intergenic
1057140984 9:92726687-92726709 TGGGGGACACAGCAGACCCAGGG + Intronic
1057355396 9:94327496-94327518 TAGGGACCAACGAAGAACCAGGG + Intronic
1057652359 9:96930126-96930148 TAGGGACCAACGAAGAACCAGGG - Intronic
1059268044 9:113054373-113054395 TAGGGAAGAGAAGAGAGCCAGGG - Intronic
1059656913 9:116365646-116365668 TAGGGAGCAAAGATGAGACAAGG - Intronic
1061203028 9:129148127-129148149 CAGGAAACCCAGCAGAGCCAAGG - Exonic
1061373284 9:130209924-130209946 TGGGGATTAGAGAAGAGCCATGG - Intronic
1062131453 9:134896228-134896250 TCGGGAAGCCAGCAGAGCCAAGG + Intergenic
1186250994 X:7666479-7666501 AAGGGGACAGAGAAGAGCCTTGG + Intergenic
1188592532 X:31855283-31855305 TAGGGAATACAGTAGATCTAAGG + Intronic
1188601464 X:31970915-31970937 GAAGGAACAAATAAGAGCCATGG - Intronic
1189341779 X:40210007-40210029 GAGGGAACACAAAAGTGCCCAGG + Intergenic
1189977025 X:46472038-46472060 TAGGGTACACAGAATTTCCATGG - Intronic
1190711585 X:53075425-53075447 TAGATAACAAAGAAGAGACACGG - Intronic
1190874680 X:54451234-54451256 CAGGGCAGACAGAAGAGTCAGGG - Intronic
1192365945 X:70473260-70473282 TATGGAACACAGGAAAGCAAGGG - Intronic
1193364101 X:80609827-80609849 TTAGGAACACAGATGAGTCATGG - Intergenic
1194142518 X:90222752-90222774 TAAGGGACATAGGAGAGCCAGGG + Intergenic
1194171640 X:90592243-90592265 TAGGCAACCCAGAATAGCCAGGG + Intergenic
1194598013 X:95883288-95883310 TAGAGAACACAGTGTAGCCAGGG + Intergenic
1198303819 X:135359928-135359950 TGGAGAATAGAGAAGAGCCATGG + Exonic
1199168404 X:144705257-144705279 TAGGGAAAACAGAAAAGCCCAGG - Intergenic
1200488273 Y:3791853-3791875 TAAGGGACATAGGAGAGCCAGGG + Intergenic
1200517871 Y:4169993-4170015 TAGGCAACCCAGAATAGCCAGGG + Intergenic
1200685516 Y:6254958-6254980 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1200991046 Y:9346199-9346221 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1200996367 Y:9386810-9386832 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1200998882 Y:9455365-9455387 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1201001536 Y:9475674-9475696 GAGGGAACAGAGAAGAGGCCAGG - Intronic
1201004202 Y:9495976-9495998 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1201006857 Y:9516288-9516310 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1201009509 Y:9536594-9536616 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1201012100 Y:9557296-9557318 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1201047362 Y:9901135-9901157 GAGGGAACAGAGAAGAGGCCAGG + Intergenic
1202131979 Y:21621043-21621065 GAGGGAACAGAGAAGAGGCCAGG + Intergenic
1202196729 Y:22305656-22305678 GAGGGAACAGAGAAGAGGCCAGG - Intergenic