ID: 997867768

View in Genome Browser
Species Human (GRCh38)
Location 5:137479882-137479904
Sequence GCATCAAGAAATTATATAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997867766_997867768 -6 Left 997867766 5:137479865-137479887 CCTGGATTCAAACCACTGCATCA 0: 1
1: 0
2: 2
3: 17
4: 221
Right 997867768 5:137479882-137479904 GCATCAAGAAATTATATAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997867768 Original CRISPR GCATCAAGAAATTATATAGT AGG Intronic
No off target data available for this crispr