ID: 997868032

View in Genome Browser
Species Human (GRCh38)
Location 5:137482077-137482099
Sequence TGTCGGGGATAGAAATTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997868022_997868032 22 Left 997868022 5:137482032-137482054 CCTGGCAAGTGACTGGCCAGGGC 0: 1
1: 0
2: 1
3: 19
4: 180
Right 997868032 5:137482077-137482099 TGTCGGGGATAGAAATTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 89
997868023_997868032 6 Left 997868023 5:137482048-137482070 CCAGGGCAGAGATAGCAACCCAT 0: 1
1: 0
2: 0
3: 14
4: 95
Right 997868032 5:137482077-137482099 TGTCGGGGATAGAAATTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 89
997868019_997868032 28 Left 997868019 5:137482026-137482048 CCTTTACCTGGCAAGTGACTGGC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 997868032 5:137482077-137482099 TGTCGGGGATAGAAATTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997868032 Original CRISPR TGTCGGGGATAGAAATTGGG AGG Intronic
900859562 1:5218376-5218398 TGTCTGTGAAATAAATTGGGAGG + Intergenic
903008327 1:20312959-20312981 TGTTGGGGATCGAACATGGGAGG - Exonic
907945240 1:59129968-59129990 TGTCGGGGATACAGATGGGAAGG - Intergenic
908835476 1:68225159-68225181 AGTCAGGGATAGAATGTGGGGGG + Intronic
911412283 1:97524779-97524801 AGTTAGGGATAGAAATTTGGGGG - Intronic
917218923 1:172706693-172706715 TGGCAGGAACAGAAATTGGGAGG - Intergenic
917447823 1:175121566-175121588 TGACAAGGATAGAAGTTGGGAGG + Intronic
918251116 1:182704465-182704487 TGTGGAGGACTGAAATTGGGAGG - Intergenic
1063053560 10:2478602-2478624 TGTCTGGGTTAGCAATGGGGTGG - Intergenic
1065362223 10:24899237-24899259 TGTGGGAGACACAAATTGGGGGG - Intronic
1069429833 10:68324581-68324603 TGTGGAGGGTAGATATTGGGAGG - Intronic
1070519253 10:77237733-77237755 TGGCGGGGAATGAAAATGGGTGG - Intronic
1077404932 11:2378590-2378612 TGTCGGTGTTAGAATTGGGGAGG + Intronic
1087279431 11:96193391-96193413 TCTGGGGAATAGAAATTGTGTGG + Intronic
1090178518 11:124673418-124673440 TGTCAGGGATGGTAAGTGGGGGG + Intronic
1094279427 12:28719115-28719137 TTTTGGGGCTAGAAATTAGGTGG - Intergenic
1097006882 12:55926458-55926480 TGATGGTGATAGAAATTGAGGGG - Intronic
1098342406 12:69466228-69466250 TTTCTGGGATAGCAATTGTGGGG - Intergenic
1102879783 12:116475385-116475407 TGGAGGGGATAGAAAAGGGGAGG + Intergenic
1107082351 13:36388334-36388356 TTTCAGGGATAGAAATTGTTGGG + Intergenic
1124414651 15:29465111-29465133 TATCGGGGGCAGACATTGGGTGG - Intronic
1125015351 15:34928342-34928364 TGTCGGGGATGGGAGTTGAGGGG - Intronic
1129310221 15:74702385-74702407 TGCCTGGGGTAGAAAATGGGAGG + Intergenic
1131505232 15:93011951-93011973 TGTCATTGATAGAAATTTGGAGG + Intronic
1135136097 16:19885996-19886018 CGACGGGGGTAGAGATTGGGGGG - Intronic
1139891075 16:70253588-70253610 GGTCTGGGATTGAGATTGGGAGG - Intronic
1141685407 16:85567072-85567094 TTTCCAGGAGAGAAATTGGGCGG - Intergenic
1142665371 17:1460213-1460235 TTTCTGAGATAGGAATTGGGAGG + Intronic
1142794987 17:2300671-2300693 TGTCGGGGAAAGAGTTTGGGAGG + Intronic
1144466813 17:15503814-15503836 TGTTTGGGATAGAACTTCGGTGG - Intronic
1145899170 17:28478838-28478860 TGTTGGGAAGAGAAAGTGGGAGG + Intronic
1146704184 17:34988312-34988334 TGTTGGGGATGGAATTTGGGAGG + Intronic
1148366978 17:47062761-47062783 CTTCGGGGAGGGAAATTGGGAGG + Intergenic
1148958450 17:51372922-51372944 AGTCTGGGACAGAAATTGGCTGG - Intergenic
1152191793 17:78892618-78892640 TGTACAGGACAGAAATTGGGAGG - Intronic
1152533763 17:80938254-80938276 CGTGGGGGGTAGAAATGGGGCGG - Intronic
1153286645 18:3462203-3462225 TGTCAAGGACAGAAATGGGGTGG - Intergenic
1155622549 18:27795949-27795971 TGAAGGGGATAGAAAAAGGGAGG - Intergenic
1156228126 18:35129105-35129127 TGTTGGGGGCAGAAATGGGGAGG - Intronic
1159300305 18:66556427-66556449 TGTCGGGGATATGAAGAGGGAGG - Intronic
1166259445 19:41627461-41627483 TCTGTGGGATAGAAAATGGGGGG + Intronic
1168493761 19:56833491-56833513 TGTCGGGCATTTAAACTGGGAGG - Intronic
925391771 2:3500160-3500182 TTTCAGGGAGAGAAACTGGGAGG + Intronic
928877750 2:36060547-36060569 TCTGGGTGAAAGAAATTGGGAGG + Intergenic
931140707 2:59454613-59454635 TGTGGGAGAAAGAAATTAGGAGG + Intergenic
935645455 2:105330072-105330094 TGTAGGTGACAGAAACTGGGTGG - Intergenic
937814238 2:126233609-126233631 TAGAGGAGATAGAAATTGGGTGG - Intergenic
946078902 2:217099659-217099681 CCTTGGGAATAGAAATTGGGTGG - Intergenic
946999292 2:225435149-225435171 TGTCTGGGATATAAATTCAGAGG - Intronic
1173093172 20:39995792-39995814 TGTAGGGGAGGGAAACTGGGGGG - Intergenic
1174280706 20:49437190-49437212 GGTGGGGCACAGAAATTGGGTGG + Intronic
1176723648 21:10412963-10412985 TGTTGGGAAAAAAAATTGGGGGG - Intergenic
1179264830 21:39794139-39794161 TGTCGGGGTTAGAATTTTAGAGG + Intronic
1203303458 22_KI270736v1_random:93224-93246 TGTCGTGGATAGGAATGGAGTGG + Intergenic
949148381 3:732450-732472 TGTAGTGGAAATAAATTGGGTGG - Intergenic
950682080 3:14592420-14592442 AGTCGGGGAAAGAAAGAGGGTGG + Intergenic
956714629 3:72067774-72067796 AGTCGGGGATGGAAATTAGGAGG - Intergenic
963465798 3:145680234-145680256 TGTCGTGTATAGAATTTGAGGGG + Intergenic
963853518 3:150231083-150231105 TGCCTGGGATAGAAATAGGTGGG + Intergenic
964168777 3:153741731-153741753 TGTGGGGGATGGATATTGGGAGG - Intergenic
974210744 4:58771367-58771389 TGTTGGAGTTAGAAATTTGGGGG + Intergenic
977247774 4:94653948-94653970 TGTGGGGAAGAGAAATTGTGGGG + Intronic
990465987 5:56071869-56071891 TGTGTGGGAAAGAAATGGGGAGG + Intergenic
991173494 5:63657223-63657245 TGTCAGGAATAGAAATTGTAGGG - Intergenic
993772264 5:91944128-91944150 TGCAGAGGATAAAAATTGGGTGG - Intergenic
997868032 5:137482077-137482099 TGTCGGGGATAGAAATTGGGAGG + Intronic
1002427933 5:179186770-179186792 TGTCTGGCAGAGAAAGTGGGTGG - Intronic
1004961759 6:20798186-20798208 TTTAGGGGTTAGAGATTGGGAGG + Intronic
1010886575 6:81250556-81250578 AGTGAGGGATGGAAATTGGGAGG - Intergenic
1012270211 6:97199997-97200019 AGTCAGGGAGAGAAATTGAGAGG - Intronic
1014985555 6:128002791-128002813 TTTCGTGGTTATAAATTGGGAGG + Intronic
1015297561 6:131615214-131615236 GGTCGGGGCTTGAAATTGGCAGG - Intronic
1021521003 7:21538806-21538828 TGTCGGCTATAGAACATGGGTGG + Intergenic
1025143076 7:56482032-56482054 TGTTGGGTATAAAAACTGGGGGG - Intergenic
1025258666 7:57402687-57402709 TGTTGGGTATAAAAATTGGGGGG - Intergenic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1026309730 7:69173224-69173246 TGTGGGGGATGGAAAGCGGGAGG - Intergenic
1027126419 7:75559724-75559746 TGTCTGAGATAGAAAGTGAGCGG - Exonic
1033045839 7:137961631-137961653 TGTCTGGCATAGAAATGGGGAGG - Intronic
1033552584 7:142461262-142461284 TCTCTGGGATAGAAATTGATTGG - Intergenic
1033559467 7:142517760-142517782 TCTCTGGGATAGAAATTGATTGG - Intergenic
1034502933 7:151462722-151462744 TGTTGGGTATAAAAGTTGGGGGG - Intergenic
1036287722 8:7459538-7459560 TGTCTGGGATAGGGATTGTGCGG - Intronic
1041021699 8:53644510-53644532 AGTTGGGGACAGAAATGGGGAGG + Intergenic
1044028697 8:87207559-87207581 TGTAGGGGAGTGAAATTGAGGGG + Intronic
1053364640 9:37513928-37513950 TATGGGGGATAGAAGTTGGTGGG + Intronic
1057983614 9:99687228-99687250 ATTGGGGGATAGAAAGTGGGAGG + Intergenic
1058301608 9:103380390-103380412 TGTGGGGGATAAAAAGAGGGTGG - Intergenic
1060683682 9:125588395-125588417 TGACGGGGTGGGAAATTGGGAGG + Intronic
1186885022 X:13904446-13904468 TGTGGGGGATAGAACTCAGGAGG - Intronic
1187670278 X:21659206-21659228 AATCGGGGAGAGAAATTGGAAGG - Intergenic
1189287816 X:39864685-39864707 TTGGGGGGATAGAAAGTGGGAGG + Intergenic
1193037977 X:76974019-76974041 TGTTGGGGGTAGAAATAGGAGGG + Intergenic
1196166423 X:112539915-112539937 TTACTGGGATAGAAGTTGGGGGG + Intergenic
1198137708 X:133770780-133770802 TATCTGGAATAGCAATTGGGAGG - Intronic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic