ID: 997870012

View in Genome Browser
Species Human (GRCh38)
Location 5:137498644-137498666
Sequence CGGAGGCGGGGACCCCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 6, 3: 33, 4: 318}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997869998_997870012 0 Left 997869998 5:137498621-137498643 CCAGGCGTCCCAGCGCCCCAGCC 0: 1
1: 0
2: 3
3: 47
4: 505
Right 997870012 5:137498644-137498666 CGGAGGCGGGGACCCCGCGGCGG 0: 1
1: 0
2: 6
3: 33
4: 318
997869996_997870012 8 Left 997869996 5:137498613-137498635 CCGGGCACCCAGGCGTCCCAGCG 0: 1
1: 0
2: 0
3: 16
4: 233
Right 997870012 5:137498644-137498666 CGGAGGCGGGGACCCCGCGGCGG 0: 1
1: 0
2: 6
3: 33
4: 318
997870002_997870012 -9 Left 997870002 5:137498630-137498652 CCAGCGCCCCAGCCCGGAGGCGG 0: 1
1: 0
2: 5
3: 35
4: 330
Right 997870012 5:137498644-137498666 CGGAGGCGGGGACCCCGCGGCGG 0: 1
1: 0
2: 6
3: 33
4: 318
997869997_997870012 1 Left 997869997 5:137498620-137498642 CCCAGGCGTCCCAGCGCCCCAGC 0: 1
1: 0
2: 2
3: 20
4: 229
Right 997870012 5:137498644-137498666 CGGAGGCGGGGACCCCGCGGCGG 0: 1
1: 0
2: 6
3: 33
4: 318
997870001_997870012 -8 Left 997870001 5:137498629-137498651 CCCAGCGCCCCAGCCCGGAGGCG 0: 1
1: 0
2: 0
3: 18
4: 185
Right 997870012 5:137498644-137498666 CGGAGGCGGGGACCCCGCGGCGG 0: 1
1: 0
2: 6
3: 33
4: 318
997869993_997870012 17 Left 997869993 5:137498604-137498626 CCGCGAGCCCCGGGCACCCAGGC 0: 1
1: 0
2: 3
3: 35
4: 408
Right 997870012 5:137498644-137498666 CGGAGGCGGGGACCCCGCGGCGG 0: 1
1: 0
2: 6
3: 33
4: 318
997869994_997870012 10 Left 997869994 5:137498611-137498633 CCCCGGGCACCCAGGCGTCCCAG 0: 1
1: 0
2: 1
3: 26
4: 362
Right 997870012 5:137498644-137498666 CGGAGGCGGGGACCCCGCGGCGG 0: 1
1: 0
2: 6
3: 33
4: 318
997869995_997870012 9 Left 997869995 5:137498612-137498634 CCCGGGCACCCAGGCGTCCCAGC 0: 1
1: 0
2: 3
3: 34
4: 405
Right 997870012 5:137498644-137498666 CGGAGGCGGGGACCCCGCGGCGG 0: 1
1: 0
2: 6
3: 33
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997870012 Original CRISPR CGGAGGCGGGGACCCCGCGG CGG Intronic