ID: 997872046

View in Genome Browser
Species Human (GRCh38)
Location 5:137514862-137514884
Sequence CTCTAGAAGGAGAAGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997872042_997872046 -8 Left 997872042 5:137514847-137514869 CCAAGTCAGAGTATCCTCTAGAA 0: 1
1: 0
2: 1
3: 5
4: 96
Right 997872046 5:137514862-137514884 CTCTAGAAGGAGAAGTTGCAGGG 0: 1
1: 0
2: 0
3: 19
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997872046 Original CRISPR CTCTAGAAGGAGAAGTTGCA GGG Intronic
901021336 1:6257484-6257506 CTCTTAGAGGAGAAGGTGCAGGG - Intronic
902442962 1:16443135-16443157 CTATAGAAGCAGCAGCTGCAGGG - Intronic
902690922 1:18109749-18109771 CTCTAGAGGGAAAGGTTACATGG + Intronic
903262773 1:22140248-22140270 CTCTAGAAGGAAAAGCTTCGGGG - Intronic
903618735 1:24682188-24682210 CTCCGGAAGCAGAGGTTGCAGGG - Intergenic
904687805 1:32273541-32273563 CTAGAGAAGGAGGAGCTGCAGGG + Intronic
904952874 1:34258351-34258373 TCCTAGAATGAGAAGTTACATGG + Intergenic
906829727 1:49018417-49018439 CTCTAGGAGAAGAGGTGGCAAGG - Intronic
908449282 1:64235322-64235344 CCCTAGAAGAAGAAGAGGCAGGG - Intronic
909176143 1:72362584-72362606 CTCTGGCATGAGAAGTTGAAAGG - Intergenic
911146752 1:94559849-94559871 CTCTAGGGGGACAAGTTGAATGG - Intergenic
911808901 1:102248122-102248144 CTGAAGAAGAATAAGTTGCATGG - Intergenic
912339933 1:108903504-108903526 CTCTACATGGAGAAGTAGCATGG + Intronic
912837645 1:113010469-113010491 CTCTGGAAGCGGAGGTTGCAAGG - Intergenic
913095052 1:115508667-115508689 CTCTAGACAGAGAAATTGCCTGG - Intergenic
914912465 1:151798959-151798981 CTAAAGAAGGGGAAGTTGCTGGG + Intergenic
916126216 1:161573752-161573774 CTCTAGAATGTGAAGGTGGAAGG - Intergenic
916136134 1:161655592-161655614 CTCTAGAATGTGAAGGTGGAAGG - Intronic
916998673 1:170330643-170330665 CTTTAGAAGGTGCAGTTTCATGG - Intergenic
917179184 1:172275806-172275828 CTCTTCAAGGAGAAATTTCAAGG - Intronic
917795895 1:178532529-178532551 CTCCAGAAGGAAAAGCGGCAAGG + Intronic
921325780 1:213985348-213985370 CTCTAGCAAGAGAGGTTGCCAGG + Intronic
921475282 1:215599775-215599797 TTACAGAAGGAGAAGTAGCAAGG + Intronic
1065127268 10:22585674-22585696 CTCAGGAGGCAGAAGTTGCAGGG - Intronic
1068242963 10:54328580-54328602 GTCTAGAAGGAGATGTTGGATGG + Intronic
1069878878 10:71579556-71579578 CTCCAGAAGGAGAATCTCCATGG - Intronic
1070610998 10:77932501-77932523 CTCAAAAAGGAGAAGTGGCTGGG + Intergenic
1071492443 10:86144872-86144894 GTTTAGGAGGAGAAGTTGAAAGG - Intronic
1072982936 10:100114962-100114984 CTCTTTAAGGAGGAGTTGGACGG - Intergenic
1073006929 10:100331375-100331397 CTCAAGGAGGAGAAACTGCAGGG - Intergenic
1074706227 10:116134484-116134506 CTCTTGAAGGATCAGTTACAAGG - Intronic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1078275594 11:9842295-9842317 TTCTAGAAGGATAAGATACAGGG + Intronic
1079592760 11:22200861-22200883 ACCTAGAAGGAGAAGTTGTATGG + Intronic
1080527834 11:33144898-33144920 CCCGGGAGGGAGAAGTTGCAGGG + Intronic
1082138892 11:48583112-48583134 CCCTTGATGGAGAAGTAGCAGGG + Intergenic
1082896899 11:58201330-58201352 CTCTTGATGGAGAAGTGGTAGGG + Intergenic
1088597985 11:111454146-111454168 CTCTATAGGAAGAAGATGCATGG + Intronic
1088898033 11:114092551-114092573 CTCTCCAAAGAGAAGTTTCAGGG + Intronic
1089757229 11:120695854-120695876 CTCTGGAAGGAGCAATTGAAGGG + Intronic
1091107305 11:132934684-132934706 TTCCAGAAGTAGAAGTTGAAAGG - Intronic
1091576231 12:1738453-1738475 CTCTAAAATGAGAAATTACAGGG - Intronic
1092531936 12:9352142-9352164 CTGTAGAAGGAGAGGCTGCCGGG - Intergenic
1092871284 12:12808004-12808026 CTCCAGAAGGAGAGGTCGAAGGG - Intronic
1093053455 12:14531704-14531726 CCCTGGAAGCAGAGGTTGCAGGG - Intronic
1093179729 12:15953394-15953416 GTCTAGAAAGTAAAGTTGCAGGG + Intronic
1094502819 12:31036042-31036064 CTGTAGAAGGAGAGGTTGCCAGG - Intergenic
1096017127 12:48286768-48286790 CACTAGAAGGGGAAATTGAAGGG - Intergenic
1096266519 12:50127267-50127289 CTCTTGATGAAGAAGTGGCAAGG - Intergenic
1097163921 12:57071747-57071769 CTCAAGAGGCAGAGGTTGCAGGG + Intronic
1097287861 12:57891426-57891448 CCCAGGAAGCAGAAGTTGCAGGG + Intergenic
1100180044 12:92075095-92075117 CACTAGAAGGGGAGGTTGAATGG + Intronic
1100359902 12:93867113-93867135 CTCAAGAATTAGAAGTAGCAGGG - Intronic
1102736155 12:115161989-115162011 CTCTAAAATGAGAGTTTGCAGGG + Intergenic
1103883748 12:124186006-124186028 CTGTAAAAGGAGAATTTGAACGG - Intronic
1104811321 12:131621961-131621983 CTCTGGCAGGAGAGGCTGCAGGG + Intergenic
1107108155 13:36668689-36668711 CCCTAGATGGAGAAGTTACCTGG + Intergenic
1107943240 13:45393189-45393211 CTCTGCATGGAGAAGTTGCTGGG - Intergenic
1108141635 13:47428749-47428771 CTCCAGAAGCAGAAGTTGACAGG - Intergenic
1111257292 13:85687053-85687075 TTCTAGAAGAAGAAAATGCATGG + Intergenic
1112206057 13:97324413-97324435 CCCTAGCAGGAGAAATTCCAAGG + Intronic
1115055653 14:29122796-29122818 CTCTAGTAGGAAAATTAGCAGGG - Intergenic
1115900772 14:38145066-38145088 CTGGAGAAGGAGAAGTTACCTGG + Intergenic
1116722261 14:48512820-48512842 TTCTAGATTGAGAAGTTACAAGG + Intergenic
1121551267 14:94803108-94803130 CTCTGGAAGTGGAGGTTGCAGGG + Intergenic
1121712189 14:96046750-96046772 CTTTAGAAGGGGAATTAGCAGGG - Intronic
1122028304 14:98893874-98893896 TTCTAGCAGGTGCAGTTGCAAGG - Intergenic
1122284295 14:100641731-100641753 GACTAGAAGCAGAAGATGCAGGG - Intergenic
1122966419 14:105129524-105129546 CTCAAGAAACAGAAGTCGCAAGG - Intergenic
1123716870 15:23039964-23039986 CACTGGAGGGAGAAGCTGCAGGG - Intergenic
1123824989 15:24072223-24072245 CTCTAGAAGCAGGAAATGCAGGG + Intergenic
1124393828 15:29283194-29283216 CACTTGAAAGAGAAGTTGCAAGG + Intronic
1125050635 15:35294500-35294522 CTGTTGAAGTTGAAGTTGCAAGG - Intronic
1126796895 15:52266840-52266862 CTCTTGAAGGGAGAGTTGCAGGG + Intronic
1138586185 16:57971696-57971718 ATCTAGGAGGAGAGGGTGCAAGG + Intergenic
1140066401 16:71615139-71615161 CTCTAGATGGGGCAGTAGCAAGG + Intergenic
1140228730 16:73099887-73099909 AGCCAGAAGGAGAAGTTCCAAGG - Intergenic
1142189547 16:88711614-88711636 CCCTAGAGGGAGAAGCAGCAGGG - Exonic
1142724893 17:1805734-1805756 CTCAGGAAGCAGAGGTTGCAGGG + Intronic
1142930849 17:3282956-3282978 TTTTAGATGGAGAAGTTTCAAGG - Intergenic
1143740030 17:8945714-8945736 CTCTTGATGGAGAAGTGGCAAGG - Intronic
1144907861 17:18651242-18651264 CTCTATATGTTGAAGTTGCATGG - Intronic
1146525385 17:33563013-33563035 CTCTAGGAGGAGCTGTTGCAGGG + Intronic
1146932654 17:36788572-36788594 CTCTTGATGGGGAAGTTACAAGG + Intergenic
1147986561 17:44310469-44310491 CCAGAGAAGGAGAAGTTGAAGGG + Intronic
1148187096 17:45652241-45652263 TTCTAGAATAAGAAGTTGCCAGG + Intergenic
1148376229 17:47149001-47149023 CTCGGGAAGCAGAGGTTGCAGGG + Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1148939420 17:51195265-51195287 AAATAGAAGGAGAGGTTGCATGG + Exonic
1154145637 18:11864160-11864182 CCCAAGAGGCAGAAGTTGCAGGG - Intronic
1155612649 18:27684306-27684328 CTCTAGAAGGGGAGGATTCAGGG + Intergenic
1155702804 18:28768894-28768916 CTCTCTTAGGAGAAGTTGTAAGG + Intergenic
1157405565 18:47419762-47419784 CACTAGATGGAGAAGGTGCTGGG + Intergenic
1158901296 18:61964257-61964279 CCATAGAATGAGAAGTTGGAGGG - Intergenic
1159693467 18:71522111-71522133 CCCTAGAAGGAGAAAAGGCAAGG + Intergenic
1160839837 19:1141288-1141310 CTCGGGAAGCAGAGGTTGCAGGG - Intronic
1161379850 19:3959123-3959145 CTGGAGCAGGAGAAGCTGCAGGG - Exonic
1162331491 19:10032611-10032633 CTCTCGAAGGGGAAATTGCTGGG + Intergenic
1164055420 19:21618081-21618103 CTCTGGAAGGAGAAGACGAAGGG - Intergenic
1164536630 19:29090735-29090757 TTTTAGAAGGAGAATTTCCAGGG - Intergenic
1164763589 19:30746093-30746115 CTCTAGAAGAGGAAGATTCATGG + Intergenic
1166534640 19:43564932-43564954 CTCGAGAAGCCGAAGATGCAAGG - Intronic
1166555625 19:43697854-43697876 ATGTAGAAGGAGGAATTGCAGGG - Intergenic
1166651729 19:44580311-44580333 GTCTTAAAGGGGAAGTTGCAGGG - Intergenic
925130576 2:1491323-1491345 CTCTAGAGGGAAAATATGCAAGG - Intronic
926463056 2:13157534-13157556 CTCTAGAAGCTGAAAATGCAAGG - Intergenic
927201692 2:20582320-20582342 CTCTAGAAGGAGAGCTGACATGG + Intronic
928942641 2:36742161-36742183 CTCCAGAAGGAAAAGGTCCAAGG - Intronic
929191913 2:39147955-39147977 TCCTAGAAGGAGAAGGTGCCCGG + Intergenic
930122956 2:47774823-47774845 CTGTAGTAGGAGAAGTTGAAGGG + Intronic
932656839 2:73617872-73617894 CTCTTGAAGGAGAAGTAGAGAGG + Intergenic
932663511 2:73678148-73678170 CTCTTGAAGGAGAAGTAGAGAGG + Intergenic
932890489 2:75592109-75592131 CTGGTCAAGGAGAAGTTGCAAGG + Intergenic
933126498 2:78614564-78614586 CTTTAGCAGGTGAAGTTGAAAGG - Intergenic
933382297 2:81564575-81564597 ATCTTGAAGGATAATTTGCAGGG - Intergenic
935838487 2:107081009-107081031 CTCTATAAGGAGGAGATGCTGGG + Intergenic
936064196 2:109318283-109318305 CGCTAGGAGGAGCAGTCGCATGG - Intronic
942812042 2:180010910-180010932 CTGTAGAGGGAGAAGTTGCCCGG - Intergenic
942913734 2:181277543-181277565 TTCTCGAAGGAGAAGTGGGATGG + Intergenic
945274804 2:207977466-207977488 CTGTAGAAGTATAAGTTGTAAGG + Exonic
949010219 2:241674069-241674091 CCCTAGAAGGAAAAAGTGCAAGG + Intergenic
1172212011 20:33206686-33206708 CTCTGGAGGCAGAGGTTGCAGGG - Intergenic
1172694680 20:36814378-36814400 ATTTAGAAGGACAAGCTGCAAGG + Intronic
1173045028 20:39501627-39501649 CTTTAGAAAGACAAGTGGCAGGG - Intergenic
1176205136 20:63884069-63884091 TTCTCGAAATAGAAGTTGCAGGG - Intronic
1176335666 21:5595757-5595779 CTCTAGGAGGAAAAGCTGCTGGG - Intergenic
1176392091 21:6225191-6225213 CTCTAGGAGGAAAAGCTGCTGGG + Intergenic
1176469328 21:7090983-7091005 CTCTAGGAGGAAAAGCTGCTGGG - Intergenic
1176492889 21:7472761-7472783 CTCTAGGAGGAAAAGCTGCTGGG - Intergenic
1176507753 21:7665622-7665644 CTCTAGGAGGAAAAGCTGCTGGG + Intergenic
1178972851 21:37196310-37196332 CTCGGGAGGGAGAGGTTGCAGGG - Intronic
1180990742 22:19934232-19934254 CTCTAAAAGGAGAAACTGCAGGG + Intronic
1181666169 22:24399156-24399178 CTCCAGAGGGAGACGTTTCATGG - Intronic
1181855809 22:25780718-25780740 CTCCAGAAGGGGACGTTCCAGGG - Intronic
1182975807 22:34623100-34623122 TTCTGGAGGGAGAAGTTGAAAGG + Intergenic
1184263551 22:43333516-43333538 CTCAAGCAGCAGAAGTTTCAAGG + Intronic
1184858745 22:47161146-47161168 CTCTAGAAAGAGACGGTGCCTGG + Intronic
950083194 3:10238429-10238451 CTCTAGGTGGAAAAGTTTCAGGG + Intronic
951097513 3:18649134-18649156 CTCTGGAGGCAGAGGTTGCAGGG + Intergenic
952694174 3:36246783-36246805 CTCTAGAAAGTGAATTTGGAGGG - Intergenic
953317062 3:41938604-41938626 CTCAGGAGGCAGAAGTTGCAGGG + Intronic
954477637 3:50763355-50763377 CCCGGGAAGCAGAAGTTGCAGGG - Intronic
954753220 3:52825175-52825197 AAATAGAAGGAAAAGTTGCAGGG - Intronic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
958270244 3:91490687-91490709 CTGTAGAAGGAGGACTTGTAGGG - Intergenic
959833804 3:110894906-110894928 CTGTAGAAAGAGAACTTGCTGGG - Intergenic
960113329 3:113867366-113867388 CCCTGGATGCAGAAGTTGCAGGG - Intronic
961935205 3:130575683-130575705 CTCCAGAAGGAGAAGGTACTAGG + Intronic
963334746 3:143961799-143961821 CTCGAGAAGCAGAACTTGAATGG + Intergenic
964876548 3:161373565-161373587 CTCCAGTTGGAGTAGTTGCAAGG - Intergenic
965190622 3:165523556-165523578 CTCAAGAAGGAGAAGTCAGAGGG - Intergenic
965327470 3:167324890-167324912 TTGTAGAAGAAGAAGTTGGAAGG - Intronic
967138685 3:186534249-186534271 GTTGAGAAGCAGAAGTTGCACGG + Intergenic
970702122 4:18754430-18754452 CTCTTGATGGAGAAGTTTTAGGG - Intergenic
971045671 4:22802614-22802636 CTCAAGAGGCAGAGGTTGCAGGG - Intergenic
971264114 4:25083147-25083169 CCCTTGAAAGAGAAGATGCATGG + Intergenic
971318343 4:25585641-25585663 CTCTGGAGGTAGAGGTTGCAGGG - Intergenic
975695514 4:77008935-77008957 CTTTAGATGGAGAAGTGGAAAGG + Intronic
975971519 4:80043992-80044014 CTCTAGAATCAGAATTGGCAAGG + Intronic
976458958 4:85285104-85285126 CTAAAGCAGGAGAAGTTGCTAGG + Intergenic
979654729 4:123179207-123179229 ATCTAGAAGGAGGAGTAGGATGG + Intronic
984673920 4:182524952-182524974 CCCAAGAAGTGGAAGTTGCAGGG + Intronic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
986637832 5:9841306-9841328 TCCTAGAAGGAGAAGATGAAAGG - Intergenic
986787185 5:11125230-11125252 CTCTAGGTGCAGAGGTTGCAGGG + Intronic
987160809 5:15140230-15140252 CTCCTGAAGGAGAAGTCTCAGGG - Intergenic
987334967 5:16890762-16890784 CCCGAGAAGCAGAGGTTGCAGGG + Intronic
987413866 5:17642661-17642683 CTCTGGAGGTGGAAGTTGCAGGG - Intergenic
988275898 5:29080651-29080673 CACTATAAGAAGATGTTGCAGGG - Intergenic
989636050 5:43534888-43534910 CTCTATATGTTGAAGTTGCATGG + Exonic
990192511 5:53275736-53275758 CTGTAAAAAGAGAACTTGCAGGG + Intergenic
990390466 5:55314557-55314579 CTCTAGAAGTGGAAGTGGCAAGG + Intronic
991901370 5:71463750-71463772 CTCAAGAAGTAGAGGTTACATGG + Intronic
991929410 5:71737665-71737687 CTCTATAAGTAGTAGTTGCAAGG - Intergenic
992544409 5:77797429-77797451 CTCTAGAAGAAGAAGGTGAAAGG + Intronic
993220772 5:85094193-85094215 CTCTTGATGGAGAAGGTGCAAGG - Intergenic
995751667 5:115458708-115458730 TGCTAGTAGAAGAAGTTGCATGG + Intergenic
995909009 5:117163305-117163327 CTGTAGAAGCAGAAGTTTCATGG + Intergenic
996054320 5:118966613-118966635 CTATAGAAGGAAAAGTTGATAGG + Intronic
996773578 5:127110410-127110432 CTACAGAAGGAGCAGTTTCAGGG - Intergenic
997862015 5:137426925-137426947 CTCTGGAAGGAGAATGTGAATGG - Intronic
997872046 5:137514862-137514884 CTCTAGAAGGAGAAGTTGCAGGG + Intronic
998640232 5:144001979-144002001 AGCTAGAAGGAGAAGATTCATGG + Intergenic
999085762 5:148888131-148888153 CTCTGGAAGGAGCAATGGCAGGG + Intergenic
999817887 5:155196046-155196068 CTCTAGAAGCTTAAGTTGGAAGG - Intergenic
1002630312 5:180570280-180570302 CCCCAGAGGCAGAAGTTGCAGGG + Intronic
1004285878 6:14320277-14320299 CTCCAGAAGGACAAGTTACTCGG + Intergenic
1004703631 6:18102510-18102532 CTCAAAAGGCAGAAGTTGCAGGG - Intergenic
1005559048 6:27019514-27019536 CTCTAGAAGGTAAATTTGTATGG - Intergenic
1006020207 6:31113285-31113307 CTCTAGAAGGTGAAAAAGCAGGG - Intergenic
1008984911 6:57530670-57530692 CTGTAGGAGGAGGACTTGCAGGG + Intronic
1009172951 6:60423612-60423634 CTGTAGAAGGAGGACTTGCAGGG + Intergenic
1009796570 6:68476893-68476915 CTGGGGAAGGAGAAGTGGCAAGG - Intergenic
1010107561 6:72187567-72187589 CTCAGGAAGCAGAGGTTGCAGGG - Intronic
1012228252 6:96729897-96729919 CTCTAGAAGCAGAAAAGGCAAGG + Intergenic
1015534914 6:134258011-134258033 TTTTAGAAAGTGAAGTTGCAAGG - Intronic
1015808681 6:137140001-137140023 CACCAGAAGCAGAAGCTGCACGG - Intergenic
1016564552 6:145438547-145438569 CTCCAGAGGCAGAGGTTGCAGGG - Intergenic
1016821157 6:148347790-148347812 CTCTATGTGGAGAAGTTGCAGGG + Intronic
1017647932 6:156556174-156556196 CCCTAGAATGAGAAAATGCAGGG - Intergenic
1017875380 6:158519976-158519998 CTCTTGCAGGAGAAGTGGCTGGG - Intergenic
1018179421 6:161207820-161207842 TCCTAGGAGGAGGAGTTGCAGGG + Intronic
1018527246 6:164726346-164726368 CTCCAGAATGAGTAGCTGCATGG + Intergenic
1021638544 7:22715165-22715187 CACCAGAAGGAGGAGATGCAGGG + Intergenic
1023259346 7:38342602-38342624 CACTAGAATGAGAAGATTCATGG + Intergenic
1023259802 7:38346926-38346948 CACTAGAATGAGAAGATTCATGG + Intergenic
1023260278 7:38351256-38351278 CACTAGAATGAGAAGATTCATGG + Intergenic
1023261254 7:38360406-38360428 CACTAGAATGAGAAGATTCATGG + Intergenic
1023636073 7:42211954-42211976 CTCAAGAAAGAAAAGTTGAATGG - Intronic
1024009701 7:45257214-45257236 CTCCAGAAGGAAGGGTTGCACGG - Intergenic
1024578626 7:50783935-50783957 CTCCAAAAGGAGAGGTTCCACGG + Intronic
1026623743 7:71974340-71974362 CTCGGGAGGGGGAAGTTGCAGGG + Intronic
1028487946 7:91380500-91380522 CTCTAGCAGGCCCAGTTGCAAGG - Intergenic
1028741215 7:94278052-94278074 GTATGGAAGCAGAAGTTGCAGGG + Intergenic
1029352888 7:100027827-100027849 CTCTACAAGCAGAAGTCACAGGG + Intronic
1029416781 7:100448112-100448134 CCCGGGAAGCAGAAGTTGCAGGG + Intergenic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1035701004 8:1639266-1639288 CTCCAGAAGGAGCAGTGGAAAGG + Intronic
1037677018 8:21059649-21059671 ATCAAGAGGGAGAAGTTGGAAGG - Intergenic
1037957736 8:23071873-23071895 GTCTAGGAGGACAAATTGCAGGG + Intergenic
1038688631 8:29741418-29741440 TTCTAGAAGCAGGAGCTGCATGG - Intergenic
1039717688 8:40127936-40127958 CTTTTGATGGAGAAGTGGCAAGG - Intergenic
1042276514 8:67010421-67010443 CTCTAGAAGAAAAAGTTTGATGG + Intronic
1042553357 8:70013807-70013829 ATATAGAAAGATAAGTTGCAGGG + Intergenic
1042587652 8:70359553-70359575 CTCTTGAAGGGGAAGTTACAAGG + Intronic
1045649646 8:104329939-104329961 CTCTAGAATGAGGAACTGCAAGG + Intergenic
1046289306 8:112136133-112136155 GTCTAGAAGGAGAAGAGGAAAGG - Intergenic
1047140074 8:122128501-122128523 CTGTAGAAGGAAAAGATGCAAGG + Intergenic
1047551370 8:125876092-125876114 TTTAAGAAGGAGAAATTGCAAGG - Intergenic
1048134752 8:131737750-131737772 CTCTAGATGGAAGAGATGCATGG - Intergenic
1053504772 9:38632312-38632334 CTCTACAATGAGAAATTGTATGG + Intergenic
1056273264 9:84967845-84967867 CACTCAAAGGAGAAATTGCAGGG + Intronic
1058376905 9:104333139-104333161 TTCTTGAAAGAGATGTTGCATGG + Intergenic
1061471500 9:130830147-130830169 CTCTAGAAGGAGAAAATTAATGG - Intronic
1203425973 Un_GL000195v1:39145-39167 CTCTAGGAGGAAAAGCTGCTGGG + Intergenic
1185929486 X:4186335-4186357 CTCTATAAAGAGGATTTGCATGG + Intergenic
1186876520 X:13823593-13823615 CTCGAGAGGCAGAGGTTGCAGGG - Intronic
1187256564 X:17648366-17648388 CAGCAGAAGCAGAAGTTGCAAGG + Intronic
1192529761 X:71873924-71873946 GTCAAGAAGCAGAAGTTTCAGGG + Intergenic
1195649879 X:107273273-107273295 CTCTAGAGAGAGAAGCTCCAGGG + Intergenic
1195891263 X:109697899-109697921 ATCTAAAGGTAGAAGTTGCAGGG + Intronic
1195901190 X:109799115-109799137 CTCTAGAAGGGGAAGGAGTAGGG - Intergenic
1197307103 X:124856256-124856278 CTCTAGAATGACAAGTCCCAAGG - Intronic
1197400551 X:125984031-125984053 TTCTTGAAGGAGAAGTCTCAGGG - Intergenic
1197613123 X:128660808-128660830 CTCCTGAAGGAGAAGTCTCAGGG + Intergenic
1200140329 X:153898047-153898069 CTCTTGATGGGGAAGTGGCAAGG + Intronic