ID: 997876518

View in Genome Browser
Species Human (GRCh38)
Location 5:137553020-137553042
Sequence TGCAACAATCTGGATGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5125
Summary {0: 1, 1: 12, 2: 161, 3: 938, 4: 4013}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997876518_997876521 11 Left 997876518 5:137553020-137553042 CCAACTCCATCCAGATTGTTGCA 0: 1
1: 12
2: 161
3: 938
4: 4013
Right 997876521 5:137553054-137553076 AATTATTTTATTCCTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997876518 Original CRISPR TGCAACAATCTGGATGGAGT TGG (reversed) Intronic
Too many off-targets to display for this crispr