ID: 997876519

View in Genome Browser
Species Human (GRCh38)
Location 5:137553026-137553048
Sequence TGCATTTGCAACAATCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2968
Summary {0: 1, 1: 5, 2: 61, 3: 662, 4: 2239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997876519_997876521 5 Left 997876519 5:137553026-137553048 CCATCCAGATTGTTGCAAATGCA 0: 1
1: 5
2: 61
3: 662
4: 2239
Right 997876521 5:137553054-137553076 AATTATTTTATTCCTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997876519 Original CRISPR TGCATTTGCAACAATCTGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr