ID: 997876520

View in Genome Browser
Species Human (GRCh38)
Location 5:137553030-137553052
Sequence TTGCTGCATTTGCAACAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997876520_997876521 1 Left 997876520 5:137553030-137553052 CCAGATTGTTGCAAATGCAGCAA 0: 1
1: 0
2: 0
3: 14
4: 153
Right 997876521 5:137553054-137553076 AATTATTTTATTCCTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997876520 Original CRISPR TTGCTGCATTTGCAACAATC TGG (reversed) Intronic
910812494 1:91252697-91252719 TTTCTGCATCTGAATCAATCAGG - Intergenic
911409986 1:97491849-97491871 TTGCTGAATTTGCTACTATTGGG - Intronic
913409837 1:118539154-118539176 TGGCTGCATTAGCAATAACCTGG - Intergenic
917092446 1:171367035-171367057 TTACTGCATTTGCCACAGTCAGG - Intergenic
917329962 1:173870542-173870564 ATGCTGCATTTGCAGAAAACTGG - Exonic
918435495 1:184507448-184507470 GTGGTTCATTTGGAACAATCTGG - Intronic
919083833 1:192896876-192896898 ATTCTGCATTTGCAACAATGTGG + Intergenic
920102752 1:203528101-203528123 ATGCTTCATTTGCAACAACATGG - Intergenic
922539303 1:226407170-226407192 TTGGTGCATTTGCAGCTGTCTGG - Intronic
1065733358 10:28729456-28729478 TTCCTACATTTCCAACAATAAGG + Intergenic
1066697461 10:38091787-38091809 TTGCTGCATTTGCAGTGATGAGG + Intergenic
1068164836 10:53316181-53316203 TTATTCCAGTTGCAACAATCAGG - Intergenic
1071227218 10:83544456-83544478 TTGCTGCAGAGGCTACAATCTGG + Intergenic
1071714169 10:88078284-88078306 ATGCAGCAGTTGCAACGATCTGG - Intergenic
1071829784 10:89360341-89360363 TGGCTGCCTTGGCAACAAGCAGG - Intronic
1071853501 10:89599728-89599750 TGGGTGCATTTCAAACAATCAGG - Intronic
1071858493 10:89649206-89649228 TGGGTGCATTTGAAACAACCTGG + Intergenic
1073685972 10:105753952-105753974 TTGCTGCTACTGCAAAAATCAGG + Intergenic
1074932398 10:118142459-118142481 TTGAAGCATTCGCAGCAATCTGG + Intergenic
1082210263 11:49492077-49492099 TAACGGCATTTGCAGCAATCTGG - Intergenic
1084761889 11:71278576-71278598 TTTCTGCATTAGCAACACACAGG - Intergenic
1084915064 11:72422464-72422486 ATGCTGCCTTTCCAACATTCTGG + Intronic
1085841946 11:80022062-80022084 TTCTTTCATTTGCAACAATATGG - Intergenic
1085992741 11:81869959-81869981 TTTCTGCATTTGCATGAATTTGG - Intergenic
1086120731 11:83302318-83302340 TTGCTGCCTCTGCCAAAATCAGG + Intergenic
1086986573 11:93256898-93256920 TTGCTGCATATGCAACATGTGGG - Intergenic
1087865741 11:103224554-103224576 TAATGGCATTTGCAACAATCTGG - Intronic
1088700823 11:112409685-112409707 TTGCTGCAATTGGAACCAGCTGG + Intergenic
1090530893 11:127590720-127590742 TTGCTGCATTCCCAGCAATTAGG - Intergenic
1092758418 12:11786758-11786780 TTGCTGCTTTTGCAGCTTTCAGG + Intronic
1094800531 12:34028625-34028647 TTGTGTCATTTGCAACAATATGG - Intronic
1095113327 12:38322916-38322938 TTGTGTCATTTGCAACAATATGG - Exonic
1100710695 12:97253064-97253086 TAGCTGCAATTGCAATCATCTGG - Intergenic
1101176561 12:102157511-102157533 TTGCTGTATTTCCAATAAACTGG + Intronic
1101828041 12:108235998-108236020 TTGCCGCATTTGCCACACTGGGG + Intronic
1102807883 12:115797969-115797991 GTGCTGGATTTGAAACCATCAGG - Intergenic
1104120675 12:125796338-125796360 TTGCTGCAATTGACTCAATCTGG - Intergenic
1104340519 12:127944569-127944591 TTTCTGCACTGGCAACAATGCGG + Intergenic
1106646380 13:31638666-31638688 TTGTTGAATTGGCAACTATCAGG + Intergenic
1107083408 13:36399050-36399072 ATTCTGCATTTGCAACAATGTGG - Intergenic
1108075429 13:46674438-46674460 TTCCTGCACCTGCAACAATGTGG - Intronic
1109507915 13:63331175-63331197 TAACGGCATTTGCAACAACCTGG - Intergenic
1110126941 13:71955551-71955573 TTGCTGGAGTTGAAACATTCTGG - Intergenic
1111247310 13:85556622-85556644 TACCTGGATTTCCAACAATCAGG - Intergenic
1117998678 14:61502750-61502772 TTGCTTCATTTGCAAGATTTGGG - Intronic
1121893881 14:97626367-97626389 CTGATGCCTTTGCAACAGTCGGG - Intergenic
1132194549 15:99902761-99902783 TTGCTGTATTTGAGATAATCAGG - Intergenic
1135905979 16:26512051-26512073 TTGCAGCATCTGCAACAGTCTGG + Intergenic
1138078604 16:54066903-54066925 ATGCTGCATTTGCAAAGGTCAGG + Intronic
1153394740 18:4605896-4605918 TAGCTGCTTTGGAAACAATCTGG + Intergenic
1156343378 18:36233328-36233350 TAATGGCATTTGCAACAATCTGG - Intronic
1157156514 18:45272420-45272442 TTGCAACATTTGCAACAACATGG - Intronic
1158925648 18:62255867-62255889 CTGCTGCATTAGCACTAATCAGG + Intronic
1159756015 18:72366931-72366953 TTGCTGCATTTCCTACAAACAGG - Intergenic
1160303777 18:77711854-77711876 TCCCTGCATTTGAAGCAATCAGG + Intergenic
1167941423 19:52948589-52948611 TTGCAGCCTTTACAAAAATCAGG - Intronic
1167948683 19:53009620-53009642 TTGCAGCCTTTACAAAAATCGGG - Intergenic
1167953759 19:53048002-53048024 TTGCAGCCTTTACAAAAATCAGG - Intronic
1167987400 19:53330288-53330310 TTGCAGCATTTACAAATATCAGG + Intergenic
925156353 2:1651429-1651451 TTGATGCATTTTCAAGCATCGGG - Intronic
926634146 2:15162872-15162894 CTGCTGCATTTGCAGCTAACTGG + Intergenic
927389165 2:22573687-22573709 TTTTTTCATTTGCAACAATATGG + Intergenic
932084634 2:68747146-68747168 CTGCAGCATTTGACACAATCAGG + Intronic
935142760 2:100368417-100368439 TGGCTGCAGTTGCAAGAATGTGG + Intergenic
936504150 2:113091566-113091588 TTGCTGCATGTACAAGAATCCGG - Intergenic
939696424 2:145330578-145330600 TTGATGAAATTGCAACAATACGG + Intergenic
939861305 2:147423781-147423803 TTGCTGCCTCTGCACCAGTCTGG + Intergenic
944127699 2:196313147-196313169 TTGCTGCATTGGAGACAATATGG - Intronic
945096793 2:206228121-206228143 TGGCTGCCTTTGAGACAATCAGG + Intergenic
945147686 2:206755580-206755602 TTTCTGCATGTGCATCAATAGGG + Intronic
946856045 2:223950704-223950726 TAGCTGCTTTTGCAATAAACTGG - Intergenic
1170014856 20:11769061-11769083 CTGCTGAATTTGGAAGAATCTGG + Intergenic
1171165093 20:22963118-22963140 TTTCTAGTTTTGCAACAATCTGG + Intergenic
1171970277 20:31560371-31560393 TTACTGCTTTTGCAACTATCAGG - Intronic
1173346603 20:42206157-42206179 TTGCTGCATTTGTAAGACACTGG - Intronic
1173992777 20:47315995-47316017 TTGCTGAAATTGTAACAATATGG + Intronic
1174209405 20:48865525-48865547 TTGTTTCTTTTGTAACAATCAGG - Intergenic
1177016934 21:15802507-15802529 TTACTTCATTTCCAACTATCTGG - Intronic
1179288945 21:40001545-40001567 GTGCTGCATTTGGAAAAACCTGG + Intergenic
1179369204 21:40788817-40788839 TTGCTGTCCTTGCAATAATCTGG - Intronic
1181886401 22:26025441-26025463 TTGCTGGAACTGTAACAATCAGG - Intronic
1182050044 22:27305693-27305715 ATGCTGCATTTGAAACACGCTGG + Intergenic
1182665085 22:31952156-31952178 TTGCTGCATCTCCACAAATCAGG - Intronic
1184338501 22:43870708-43870730 TTGCAGTACTTGCAGCAATCTGG - Intergenic
1184794791 22:46725816-46725838 CTGCAGCATTTGCCACAGTCTGG + Intronic
949117270 3:342017-342039 TTGCTGCATTTCCAAGATTAAGG + Exonic
952957075 3:38564023-38564045 TTGCTGCCTTTGAAAAAATATGG - Intronic
956147666 3:66207326-66207348 TTGGTGCAGTTCCAACAATTAGG + Intronic
958110668 3:89139486-89139508 TTGCTGCCTTTTCAGCACTCAGG - Intronic
962255150 3:133865470-133865492 CTGCTGCATTTCTAACCATCTGG + Intronic
962596152 3:136946035-136946057 TTCCTGCATTTCCACCACTCTGG - Exonic
962995101 3:140619237-140619259 CAACGGCATTTGCAACAATCTGG + Intergenic
964717349 3:159736593-159736615 AAGCTGCACTTGAAACAATCAGG + Intronic
964882752 3:161442619-161442641 TTTCTGCATTTGCCAAAAGCAGG - Intergenic
967099170 3:186201639-186201661 TTGCTGCATTTGTAACACAAAGG - Intronic
967298320 3:187987093-187987115 TTGCTGCATGTGCAATATTTGGG - Intergenic
970083741 4:12321309-12321331 ATGCTGCATTTGCCAAAACCAGG + Intergenic
973023817 4:45240338-45240360 TTGCTGCAGTTTCAACTCTCTGG + Intergenic
974093990 4:57342163-57342185 ATGCTGCATTTGTAATCATCTGG + Intergenic
975071411 4:70144337-70144359 TAACTGCATTTGCAAGAATGTGG - Intronic
977733627 4:100383913-100383935 TAACAGCATTTGCAACAATCTGG + Intergenic
978000125 4:103547271-103547293 TTGCTGGATTTGCAAAAACCAGG + Intergenic
978222803 4:106297460-106297482 TTGCTCCATCTGCCACAATCTGG + Intronic
979788404 4:124746496-124746518 TTGCTTCATTTGAAACATTCTGG + Intergenic
980297546 4:130942062-130942084 TTTCTGCATATGGCACAATCAGG - Intergenic
980643108 4:135604569-135604591 TTGGTGCATTTGCCACCAGCTGG + Intergenic
980665729 4:135931548-135931570 TTGTTGCATTTGTATCACTCAGG + Intergenic
982646926 4:158035889-158035911 GTGCTGTATCTGCAAAAATCTGG + Intergenic
985166328 4:187099014-187099036 TTGTGGCTTTTGCAACAATATGG + Intergenic
985371977 4:189295004-189295026 GTGCTGCACTTGCTACAATAAGG + Intergenic
985836585 5:2276481-2276503 TTGCTGAATTTCCCACATTCAGG + Intergenic
990197660 5:53336669-53336691 TTTCTGCATTTGAAGCAATTTGG + Intergenic
991157011 5:63450063-63450085 TTACTGCATTTGCACTTATCAGG + Intergenic
992359125 5:76018069-76018091 CTGCTGCCTTTTCTACAATCAGG - Intergenic
994254597 5:97578950-97578972 TTGCGGTATTTGTCACAATCAGG - Intergenic
994268493 5:97746523-97746545 TTGTTGCTTCTGCAGCAATCCGG + Intergenic
994331849 5:98515596-98515618 TTACTGCATTTGCAATAGCCAGG - Intergenic
994877202 5:105439468-105439490 ATCCTGCATTTGCAACAACATGG + Intergenic
996746039 5:126846751-126846773 TTGCCTCATTTTCATCAATCTGG - Intergenic
997345665 5:133190208-133190230 TTGCTCCCTTTGCAGCAGTCAGG - Intergenic
997417087 5:133737413-133737435 ATCCTGCATTTGCAACAACGTGG - Intergenic
997876520 5:137553030-137553052 TTGCTGCATTTGCAACAATCTGG - Intronic
998717547 5:144902625-144902647 CTGCTGGATTGGCAACAATATGG + Intergenic
1000965600 5:167652483-167652505 TTCTTGCATTTGCAACAGTGAGG + Intronic
1001373715 5:171233917-171233939 GTGGTGCATTTGTTACAATCTGG - Intronic
1003354071 6:5349311-5349333 TAGATGCTTTTGCAAAAATCAGG - Intronic
1005998095 6:30944055-30944077 ATGCTCCATTTGCAATAATGTGG - Intronic
1007989777 6:46243165-46243187 TTGTTTCAGCTGCAACAATCAGG - Intronic
1010839405 6:80630637-80630659 TTGTTGGCTTTTCAACAATCAGG + Intergenic
1011132639 6:84067190-84067212 TAACAGCATTTGCAGCAATCTGG - Intronic
1012109356 6:95208321-95208343 CTTCTGCCTTTGTAACAATCAGG + Intergenic
1015149563 6:130021163-130021185 TTGCTGCACTTGAAACTTTCCGG - Intronic
1016571501 6:145518575-145518597 TTGGTGCATTTCACACAATCTGG - Intronic
1018764040 6:166915909-166915931 ATCCTGTATTTACAACAATCAGG + Intronic
1020665828 7:11041712-11041734 TTGGTTCATTTGGAACCATCAGG + Intronic
1021130544 7:16907428-16907450 TTTATGCATTTGCAGCAACCTGG + Intergenic
1024133133 7:46377103-46377125 TTGCTGCATTTGCATCGTTGTGG + Intergenic
1026476859 7:70743919-70743941 TTGCTGCATTTTCAAAAAGCAGG + Intronic
1030450578 7:109705090-109705112 TGATTGCATTTGCAACAACCTGG - Intergenic
1031211863 7:118839453-118839475 TTTCTGCACTTGCAAAAATTTGG - Intergenic
1032424018 7:131806090-131806112 TTCCAGCATATGCTACAATCTGG - Intergenic
1032965262 7:137089756-137089778 TTGCTGTGTTTGCACCAATGTGG + Intergenic
1033082552 7:138311963-138311985 TTGCTGTATTTACCTCAATCTGG - Intergenic
1033269684 7:139919641-139919663 TCCATGCATTTGCAACACTCTGG + Intronic
1036712066 8:11086189-11086211 TTGATGCATTAGCAAGAATCTGG - Intronic
1038165721 8:25083449-25083471 TTGCTGAATTGGCAACTGTCAGG - Intergenic
1040670653 8:49686017-49686039 TAATGGCATTTGCAACAATCTGG - Intergenic
1041794203 8:61729155-61729177 TTTCTCCATTTACAAGAATCAGG - Intergenic
1042097325 8:65231412-65231434 TTGCTGGATTTTCAACAAAGAGG - Intergenic
1042465193 8:69121531-69121553 TGGTTGCATTTGCAGCAACCTGG - Intergenic
1047339182 8:123963926-123963948 ATGATGCATCTGCAACTATCTGG - Intronic
1050326549 9:4503459-4503481 TTGCAGCATTTACCACACTCAGG - Intronic
1051050037 9:12921759-12921781 TTGCTGGTTTTGCAAGGATCAGG + Intergenic
1051795678 9:20866931-20866953 ATGCAGCATTTGCTACAATTGGG - Exonic
1056295310 9:85187234-85187256 TTTCTGCATTTGCAACTCTAAGG - Intergenic
1059362406 9:113755190-113755212 ATGCTCCATTTTTAACAATCTGG - Intergenic
1060040815 9:120299280-120299302 TTGCTGTATTTTCAACATTGGGG + Intergenic
1060884637 9:127142070-127142092 TTGCTTCATTTGGAACATTCTGG + Intronic
1192629698 X:72767895-72767917 TAGTGGCATTTGCAGCAATCTGG + Intergenic
1192652012 X:72952909-72952931 TAGTGGCATTTGCAGCAATCTGG - Intergenic
1193169321 X:78317663-78317685 TTATGGCATTTGCAGCAATCTGG + Intronic
1193255843 X:79348292-79348314 TAGTGGCATTTGCAGCAATCTGG + Intergenic
1194174118 X:90625876-90625898 TTCTTTCATTTGCAACAATGCGG + Intergenic
1196248970 X:113435612-113435634 TCCCTTCATTTGCAACAATGTGG + Intergenic
1198294206 X:135269927-135269949 TTCTTTCATTTGCAACAACCTGG + Intronic
1199810968 X:151348033-151348055 TAGCTGCTTTTGAAAAAATCAGG - Intergenic
1200046851 X:153407757-153407779 CAGCTGCATTTGAACCAATCAGG - Intergenic
1200520340 Y:4203575-4203597 TTCTTTCATTTGCAACAATGCGG + Intergenic