ID: 997876521

View in Genome Browser
Species Human (GRCh38)
Location 5:137553054-137553076
Sequence AATTATTTTATTCCTTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997876519_997876521 5 Left 997876519 5:137553026-137553048 CCATCCAGATTGTTGCAAATGCA 0: 1
1: 5
2: 61
3: 662
4: 2239
Right 997876521 5:137553054-137553076 AATTATTTTATTCCTTTTTATGG No data
997876518_997876521 11 Left 997876518 5:137553020-137553042 CCAACTCCATCCAGATTGTTGCA 0: 1
1: 12
2: 161
3: 938
4: 4013
Right 997876521 5:137553054-137553076 AATTATTTTATTCCTTTTTATGG No data
997876520_997876521 1 Left 997876520 5:137553030-137553052 CCAGATTGTTGCAAATGCAGCAA 0: 1
1: 0
2: 0
3: 14
4: 153
Right 997876521 5:137553054-137553076 AATTATTTTATTCCTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997876521 Original CRISPR AATTATTTTATTCCTTTTTA TGG Intronic
No off target data available for this crispr