ID: 997878643

View in Genome Browser
Species Human (GRCh38)
Location 5:137570871-137570893
Sequence GGTCAGAAAAGACCACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997878638_997878643 22 Left 997878638 5:137570826-137570848 CCCTGGCTCAAATTTTAAAAAGT 0: 1
1: 0
2: 13
3: 92
4: 725
Right 997878643 5:137570871-137570893 GGTCAGAAAAGACCACCTGCAGG 0: 1
1: 0
2: 2
3: 14
4: 216
997878639_997878643 21 Left 997878639 5:137570827-137570849 CCTGGCTCAAATTTTAAAAAGTT 0: 1
1: 0
2: 9
3: 105
4: 913
Right 997878643 5:137570871-137570893 GGTCAGAAAAGACCACCTGCAGG 0: 1
1: 0
2: 2
3: 14
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997878643 Original CRISPR GGTCAGAAAAGACCACCTGC AGG Intronic
900108539 1:996390-996412 GGGCAGAAAGGACCCCCCGCTGG + Intergenic
900108564 1:996456-996478 GGACAGAAAGGACCCCCCGCTGG + Intergenic
900108590 1:996522-996544 GGGCAGAAAGGACCCCCCGCTGG + Intergenic
900108613 1:996588-996610 GGACAGAAAGGACCCCCCGCTGG + Intergenic
900108640 1:996654-996676 GGGCAGAAAGGACCCCCCGCGGG + Intergenic
900108689 1:996785-996807 GGGCAGAAAGGACCCCCCGCGGG + Intergenic
902295088 1:15461693-15461715 GCTCAGAAATGAGCACCAGCTGG - Intronic
902297946 1:15481230-15481252 GCTCAGAAATGAGCACCGGCTGG - Intronic
904039642 1:27576336-27576358 GGTCTGAAAAGGCCCTCTGCAGG + Intronic
904576593 1:31509021-31509043 GGTCAGAAAAGACAGCAGGCTGG - Intergenic
906876072 1:49541158-49541180 TGTGAGAAAAGACCGCGTGCTGG + Intronic
908041606 1:60119643-60119665 GGCCAAAAAGGACCACCAGCAGG - Intergenic
908628087 1:66069761-66069783 GGTCAGAAAAAACTTCCTGGAGG + Intronic
908734548 1:67262445-67262467 GGTCAGGAAAGACCACTCCCAGG + Intergenic
909840491 1:80315509-80315531 GGTCAGAAAAGACCTCTCCCAGG - Intergenic
913324357 1:117613791-117613813 AGTGAGAAAAGACCAACTGTGGG + Intronic
915274379 1:154777814-154777836 GGCCAGAACAGACCACTTGAGGG - Intronic
918124961 1:181575191-181575213 GGACAGAAAAGAACACTTGGAGG + Intronic
921221449 1:212976846-212976868 GGTCAGGAAGGAAGACCTGCAGG + Intronic
921221721 1:212978412-212978434 GGTCAGGAAGGAAGACCTGCAGG + Intronic
922759312 1:228116426-228116448 GGTCAGAAAAGACCATTTTGGGG + Intergenic
924785006 1:247186836-247186858 GTTCAGAAAATATGACCTGCTGG + Intergenic
1065850451 10:29783374-29783396 GGTCAGAAGAGCCCAGCTCCAGG - Intergenic
1066239761 10:33522267-33522289 GGGCAGAAGTGAACACCTGCAGG + Intergenic
1069557058 10:69405404-69405426 AGTCAGACAAGAACATCTGCTGG - Intronic
1070586209 10:77768671-77768693 GGGCAGACAAGACAACCTGAAGG + Intergenic
1074449609 10:113548486-113548508 GATCAGAGAAGACATCCTGCAGG - Intergenic
1077118014 11:894161-894183 GGTAAGAAAAGGCCCCCAGCAGG + Intronic
1077943252 11:6867149-6867171 GGCCAGAAAAGACCACCTGGGGG - Intergenic
1078760895 11:14251122-14251144 GGTCAGGAAATACCTCCTCCAGG + Intronic
1079315859 11:19407356-19407378 GGTCAGAAAAGACTTCCTGGAGG + Intronic
1081598476 11:44475601-44475623 GAGCAGAAAAGACCACATGTTGG + Intergenic
1081862191 11:46339564-46339586 GGTCAGATAAGACCCTCTCCTGG - Intronic
1082260749 11:50074917-50074939 GGCGAGAAAAGACCACCAGGAGG + Intergenic
1088326199 11:108604019-108604041 GGTCAGAAAAGAAGATCTGATGG + Intergenic
1089112646 11:116068930-116068952 TGTCAGAAAAGGCCAACTGCTGG + Intergenic
1089506822 11:118969041-118969063 AGTCAGAAAATAACACATGCTGG + Intergenic
1091049057 11:132351613-132351635 GGTCAAAAAAGACCTCGTGGAGG + Intergenic
1091573987 12:1715300-1715322 GGTCAAAAATGGCCACCTGAGGG - Intronic
1092726067 12:11486737-11486759 TGTCAGACAGCACCACCTGCTGG + Intronic
1093074111 12:14739494-14739516 GGAGAGCAAAGACCACCTGGTGG + Intergenic
1093577779 12:20754125-20754147 GGTTAGAAAAGATAACCTGAAGG + Intergenic
1094862328 12:34481783-34481805 AGTCAGAAAACAACAGCTGCTGG + Intergenic
1095521498 12:43072249-43072271 GATCAGAACAGACCACATGAAGG + Intergenic
1095709250 12:45270474-45270496 AGTCAGAAAAGGCCTCCTGGAGG - Exonic
1098357098 12:69622165-69622187 GTTCAGGACAGACCACCAGCTGG + Intergenic
1099305145 12:80944835-80944857 GGTCAGAAAGGCCCACCTGAGGG - Intronic
1099891135 12:88589632-88589654 GGTGAGAAAAGACCACACGTTGG + Intergenic
1100227325 12:92572355-92572377 GATCAGAAAAGACTTCCTGGAGG - Intergenic
1100937731 12:99689647-99689669 GGTCAGAAAAATTCATCTGCTGG + Intronic
1106134979 13:26967288-26967310 GTGCAGAAAAGGCCAGCTGCAGG - Intergenic
1109643463 13:65222121-65222143 AGTCAGAAAACAACAGCTGCTGG + Intergenic
1115926378 14:38440508-38440530 GGTCATATAAGACCAGCTGAAGG - Intergenic
1117008963 14:51450996-51451018 TGTCACAGAAGACCTCCTGCAGG + Intergenic
1117247384 14:53899772-53899794 GGTCTGCAAAAACCACCTGAAGG + Intergenic
1120718894 14:87869320-87869342 GATCTGACAAGACCACCTGTTGG - Intronic
1121484569 14:94304712-94304734 GGTCAGAGAAGGTCACTTGCTGG + Intronic
1124850052 15:33327888-33327910 GGTAAGAAAACACCACTTGGGGG - Intronic
1125783910 15:42298070-42298092 GGTCAGGAAAGACCTTCTGAGGG + Intronic
1129174238 15:73828674-73828696 GGTCAGGAAAGGCTTCCTGCAGG + Intergenic
1130486801 15:84402648-84402670 GATCAGAAGAGACCAGCTGGAGG - Intergenic
1130700057 15:86169316-86169338 GCCAAGGAAAGACCACCTGCAGG + Intronic
1131920456 15:97322058-97322080 GGTCACAAAAGACCATATACAGG - Intergenic
1131936622 15:97513218-97513240 AGTCAGAAAACAACAGCTGCTGG + Intergenic
1132288173 15:100680941-100680963 GGTCAGAGAAGGCTTCCTGCAGG - Intergenic
1133905385 16:10017358-10017380 AGTCAGAGAAGACTACCTGGGGG + Intronic
1134039815 16:11059971-11059993 CCACAGAAAAGGCCACCTGCAGG - Intronic
1135190357 16:20349217-20349239 GGACAGAAAAGCCCAGCTTCAGG + Intronic
1136186891 16:28593553-28593575 GGGCAACATAGACCACCTGCAGG + Exonic
1136189475 16:28607062-28607084 GGGCAACATAGACCACCTGCAGG + Exonic
1136317555 16:29463338-29463360 GGGCAACATAGACCACCTGCAGG - Exonic
1136432130 16:30202683-30202705 GGGCAACATAGACCACCTGCAGG - Exonic
1137613175 16:49832616-49832638 GGTCAGAACAGAGCACCCGAGGG + Intronic
1137697817 16:50474014-50474036 AGTCAGGGAAGACCTCCTGCAGG + Intergenic
1137926336 16:52546080-52546102 GGGCAGCAAAGGCCACCTGCGGG + Intronic
1138003600 16:53308725-53308747 GCTCAGAAAAGACCATTTGATGG + Exonic
1141097075 16:81170534-81170556 GGTCAGAGAAGACCCCCAGAAGG + Intergenic
1141702508 16:85648967-85648989 TGTCAGAAGAAACCACCCGCTGG + Intronic
1143002421 17:3803006-3803028 GGTCCGTAAAGCCCACCTGGCGG + Intergenic
1143410103 17:6703529-6703551 GGTCAGAAAAGGCCTCCTTGAGG + Intronic
1143515147 17:7415823-7415845 GGTCAGTAAAGAGCGCCAGCAGG - Exonic
1145221830 17:21095892-21095914 GGTCAGGGAAGGCCACCTACAGG + Intergenic
1145259790 17:21347808-21347830 GGTCAGGGAAGACCTCCTGGAGG + Intergenic
1145316825 17:21740130-21740152 GGTCAGGGAAGACCTCCTGGAGG - Intergenic
1148546195 17:48520807-48520829 GGACAGAGAAGACCTCCTGCAGG - Intergenic
1155150989 18:23122833-23122855 AGACAGAAATGACCACTTGCTGG + Intergenic
1155787628 18:29920483-29920505 GCTCAGAAAACAGCACCTGCAGG - Intergenic
1156667509 18:39425635-39425657 GATAAGAAAAGACCATCTGGTGG - Intergenic
1156826728 18:41438835-41438857 GGTCAGAAAATAACAGATGCTGG - Intergenic
1159186728 18:64984346-64984368 GCTCAGAAAAGACCCCCGGTGGG - Intergenic
1160049856 18:75422703-75422725 AGTCACAAAAGACCACATGTTGG + Intronic
1160413110 18:78688220-78688242 GGACAGAGAATACCACATGCTGG - Intergenic
1160739129 19:677785-677807 AGCCAGCAAACACCACCTGCGGG - Exonic
1160827620 19:1088120-1088142 GGTGAGGCAAGGCCACCTGCTGG + Exonic
1161156670 19:2735428-2735450 GGTCGGAAGAGTCCACCTCCTGG + Intronic
1161666724 19:5581638-5581660 GGTCAGAGGAGACCTCTTGCAGG + Intergenic
1164774838 19:30844849-30844871 GGTCAGAAAACAAGACCAGCTGG - Intergenic
1165175640 19:33927802-33927824 GGTGAGAATAAACCACCAGCAGG - Intergenic
1165874378 19:38995518-38995540 TGTCAGAATAGACCACCTGCAGG + Intronic
1165969825 19:39618010-39618032 GGTCAGAAAGGACCATCAGATGG - Intergenic
925826750 2:7857114-7857136 GGTAAGAAAAGACCATGTGATGG + Intergenic
926774572 2:16409147-16409169 GATGAGAAATGGCCACCTGCTGG + Intergenic
926811467 2:16758568-16758590 GGTGAGAAAAGACTTTCTGCAGG - Intergenic
927017512 2:18980590-18980612 AGCCAGAAAACTCCACCTGCAGG + Intergenic
927020397 2:19010721-19010743 GGTGAAAAGAGACCACCTGTTGG + Intergenic
928210365 2:29319447-29319469 GGACAGAAAAGCCCTCATGCAGG + Intronic
929117425 2:38456205-38456227 GGACAGAAAAGAATAGCTGCTGG - Intergenic
930119413 2:47747970-47747992 GGAAAGAAAAGCCCACCTTCGGG + Intronic
930790505 2:55322271-55322293 AGTCAGAGAAGACCTTCTGCAGG + Intronic
930944106 2:57050579-57050601 CATCAGAAAAGAACAGCTGCTGG - Intergenic
931432403 2:62218657-62218679 GCTTAGACAAGACCACCTTCTGG - Intronic
933165310 2:79068982-79069004 GGCCAGAAACCACCAGCTGCTGG + Intergenic
933547902 2:83738563-83738585 AGTCAGTAAAGAACACATGCTGG - Intergenic
937238259 2:120443396-120443418 GCTCAGAAAACTCCACATGCGGG + Intergenic
938687035 2:133748660-133748682 TGCCAGAAGAGAACACCTGCAGG + Intergenic
941656784 2:168152874-168152896 GTTTAAAAAAGATCACCTGCAGG - Intronic
942426526 2:175866243-175866265 AGTCAGAAAAGACAACTTTCTGG - Intergenic
944299320 2:198104693-198104715 AGTCAGAAAATAACACATGCTGG - Intronic
947982917 2:234425576-234425598 GGTCTGAAGGGACCACCAGCAGG - Intergenic
1169330251 20:4710563-4710585 GGTGAGAAAAGGCCTCCTCCAGG - Intergenic
1169809453 20:9594336-9594358 GGTCAACCAAGACAACCTGCAGG + Intronic
1170505476 20:17021307-17021329 GGTCAGGGAAGAACACCTGGAGG + Intergenic
1170982949 20:21231893-21231915 TGTCTGAAAAGACCTCCTCCTGG + Intronic
1171014814 20:21530691-21530713 TGATAGGAAAGACCACCTGCAGG + Intergenic
1172012515 20:31853927-31853949 GGTCAGAAAAGGCCTCTTTCAGG + Intronic
1173164626 20:40678483-40678505 GGTCAGAAAAGCCTTCCTGGAGG - Intergenic
1173441780 20:43083890-43083912 AGTCAGAAAAGACCACATCTTGG - Intronic
1173695616 20:45008687-45008709 GGTCAGAAAACAACAGATGCTGG - Intronic
1173922608 20:46757553-46757575 GCTCAGAAAATACCAACTGAAGG - Intergenic
1175111905 20:56654375-56654397 GGTCTGCGAGGACCACCTGCTGG + Intergenic
1176008615 20:62880194-62880216 GGTCAGAGAGGACCACCCCCTGG - Exonic
1181125449 22:20699338-20699360 GGACAGAAAAGGCCAGCAGCAGG - Intergenic
1181280543 22:21716789-21716811 GGACAGAAAAGGCCAGCAGCAGG + Intronic
1182388190 22:29965034-29965056 GATCAGAAAAGACTACTTGGTGG - Intronic
1183058403 22:35320641-35320663 GGTCAGAAAAGACCTCCGAGGGG - Intronic
1184390863 22:44202342-44202364 GGGCAGGCAGGACCACCTGCGGG + Intronic
1184512075 22:44939734-44939756 AGGCAGCAAAGGCCACCTGCAGG + Intronic
949150059 3:755958-755980 GGTCAGAAAACAACAGGTGCTGG - Intergenic
952502597 3:33977991-33978013 AGTCTGAAAACACCACCTGTAGG - Intergenic
953598267 3:44338201-44338223 GGTCAGGACCCACCACCTGCCGG + Intronic
954322406 3:49841097-49841119 TGCCAGAAAAGAACACCTGCAGG + Intronic
955288768 3:57671018-57671040 GGTCAGAAAAAACCCCTTACTGG + Intronic
957678790 3:83404606-83404628 GAGCTGCAAAGACCACCTGCTGG + Intergenic
963208722 3:142664211-142664233 GGACAGAAAAGACTATCTTCAGG - Exonic
964749286 3:160039679-160039701 AGTGAGAAAAGTCCAGCTGCAGG - Intergenic
965271846 3:166627395-166627417 AGTCAGAAAACAACAGCTGCTGG - Intergenic
965599014 3:170436896-170436918 GTTCTGAAGAGACCACATGCAGG + Intronic
966045839 3:175547889-175547911 AGTCAGAAAATACCAGATGCTGG + Intronic
968541485 4:1170607-1170629 GGTCCGAGAAGCCCACCTTCTGG + Intronic
969452286 4:7281471-7281493 GGACAGAAAGGCCCACGTGCTGG - Intronic
971989256 4:33869684-33869706 AGTCAGAAAACAACACATGCTGG + Intergenic
972444052 4:39126714-39126736 GGACAGCAAAGATCACCTGGTGG + Intronic
974531652 4:63115790-63115812 GGTCAGGAAACAACACATGCTGG - Intergenic
975822337 4:78284739-78284761 TGTCAGAAAAAAAGACCTGCAGG - Intronic
978069335 4:104447172-104447194 TGTTAGAAAAGACCACCTTCTGG - Intergenic
978322993 4:107518719-107518741 GGCCAGAAAAGACAACCTTGAGG - Intergenic
982023335 4:151226908-151226930 GTTCAAAAAAGACAACCTGTGGG - Intronic
982219066 4:153109522-153109544 GGTCAAAAAATAACACATGCTGG + Intergenic
982907084 4:161088155-161088177 AGTCAGAAAAGAACACATGCTGG + Intergenic
983375615 4:166923713-166923735 TGTCAGTAAAGACCAACTGTAGG + Intronic
985928007 5:3032970-3032992 GGTCAGGAACGGCCACCGGCAGG - Intergenic
985999168 5:3616634-3616656 GGTCAATGAGGACCACCTGCTGG - Intergenic
986239060 5:5940611-5940633 TGTCAGAGAAGACCAACTGCTGG + Intergenic
986958985 5:13190743-13190765 GGTCAGCAGAGTCCAGCTGCTGG + Intergenic
987147721 5:15008744-15008766 GGCCAGAACACACCGCCTGCAGG - Intergenic
988006012 5:25411654-25411676 GGTCAGGAAAGACTACTTTCAGG - Intergenic
990267898 5:54098276-54098298 GGTCAGAAAAGGCCAACAGCAGG - Intronic
990464671 5:56060825-56060847 AGGCAGAGAGGACCACCTGCAGG + Intergenic
990694159 5:58396485-58396507 TGTCAGAATAGCCAACCTGCAGG - Intergenic
992276017 5:75119747-75119769 GGTCAGAAAATAACAGATGCTGG - Intronic
996849510 5:127936773-127936795 GGTCAGATAACAGCACCTCCAGG + Intergenic
996855688 5:128003872-128003894 GGTCAGAAAAGAACCCCTCTGGG - Intergenic
997878643 5:137570871-137570893 GGTCAGAAAAGACCACCTGCAGG + Intronic
999466991 5:151816697-151816719 GGGGATAAAAGACCATCTGCTGG - Intergenic
999830285 5:155312564-155312586 TCTCAGAAATGGCCACCTGCAGG - Intergenic
1002133858 5:177096597-177096619 GATCCCAAAAGACCACCTGGAGG - Exonic
1003667580 6:8126129-8126151 AGTCAGAAAATACCAGATGCTGG + Intergenic
1006374147 6:33662674-33662696 GGTCAGAAAAGCCCTGCTTCTGG + Exonic
1006506490 6:34492173-34492195 GGTCAAAAAAGAACAGATGCAGG - Intronic
1007256516 6:40533478-40533500 GGTCAGAAAAGACTACTTGAGGG - Intronic
1010145787 6:72668436-72668458 GGACAGAAATGACCTCCTGTTGG + Intronic
1011886569 6:92103803-92103825 GGTCAGAAAATAACAGATGCTGG - Intergenic
1013782021 6:113739238-113739260 GGCCAGAAAAGTCCAGCTGTTGG + Intergenic
1014387923 6:120824205-120824227 GGTCAGAAAACAACAGGTGCTGG + Intergenic
1014420280 6:121235348-121235370 GGTAAAAAAAGACCACCAGGAGG + Intronic
1014535721 6:122610827-122610849 GGTCATCAATGGCCACCTGCAGG - Intronic
1015811640 6:137166942-137166964 GCTCAGTAAAGCCCACATGCAGG - Intronic
1015880247 6:137865037-137865059 GGACAGTAAAGACCGCCTGGTGG + Intergenic
1017360489 6:153563893-153563915 GGTCAGAAAAAGAAACCTGCAGG + Intergenic
1017599883 6:156069182-156069204 GTTCAGATAAGAGCACCCGCTGG - Intergenic
1017694388 6:157000026-157000048 AGTCAGAGAAGACAACCTGGTGG + Intronic
1018301339 6:162405788-162405810 CCTCAGGAAAAACCACCTGCTGG + Intronic
1021973282 7:25985504-25985526 GGTCAGAAAAGGCTGCCTGGAGG - Intergenic
1023740784 7:43278775-43278797 GGTCAGGAAAGACCTCCTAGGGG - Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1027122433 7:75531517-75531539 GAGCAGAAAAGCCCAGCTGCAGG + Intergenic
1029201449 7:98841927-98841949 GGTCAGACACTGCCACCTGCTGG + Intergenic
1029588068 7:101487782-101487804 GAGCAGAAAAGATCACCTTCAGG + Intronic
1032068368 7:128789723-128789745 AGTCAGAGAAGGCCACCTGGAGG + Intergenic
1035879045 8:3223819-3223841 GGTGACAAAATAACACCTGCTGG + Exonic
1036214663 8:6869004-6869026 GGCCACACAAGACCACATGCTGG + Intergenic
1036387811 8:8297049-8297071 GGCCAGGAAAGACCAACTGTGGG + Intergenic
1037635162 8:20695061-20695083 GGTCAGAAAATACTTCCTGGAGG - Intergenic
1038516249 8:28189996-28190018 AGTCAAAATAGGCCACCTGCAGG - Exonic
1040000793 8:42575041-42575063 GGTGAGAAGTGACCACGTGCTGG + Intergenic
1041215289 8:55594525-55594547 GTAGAGCAAAGACCACCTGCAGG - Intergenic
1042482174 8:69316477-69316499 GGTCATAAAAGGCCTCCTGGAGG + Intergenic
1045323473 8:101099406-101099428 AGTCAGAAAAGGCCAAGTGCAGG + Intergenic
1045484088 8:102617092-102617114 GGTCAGCAAATACTGCCTGCAGG - Intergenic
1047883368 8:129220642-129220664 GGGCAGAAAAGACCTCTTGCAGG - Intergenic
1049237854 8:141521462-141521484 GGTCAGAAACGACCCCAGGCTGG + Intergenic
1051502612 9:17794402-17794424 GGACAGAGAGCACCACCTGCCGG - Intronic
1053169715 9:35869801-35869823 GGTCAGCGAAGACTTCCTGCTGG - Exonic
1057792276 9:98132187-98132209 GGTCCCACAAGGCCACCTGCCGG + Exonic
1058915710 9:109562250-109562272 AGTCAGAGAAGACTTCCTGCTGG - Intergenic
1059150244 9:111943001-111943023 AGTCAGAAAAGCCCTCCTGGGGG - Intergenic
1062115685 9:134806881-134806903 GTCCAGGAAAGCCCACCTGCTGG + Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1186904339 X:14095320-14095342 TGTCAGGAAAGACCACTTACAGG + Intergenic
1187975342 X:24699602-24699624 GGTGACATAAGACTACCTGCAGG - Intronic
1189092776 X:38104769-38104791 TGTCACAAAAGACCACCTGGAGG - Intronic
1189529599 X:41866003-41866025 CTACAGAAGAGACCACCTGCTGG + Intronic
1190791217 X:53702097-53702119 GGTCAGAGAATACCTCCTGGTGG + Intergenic
1191113530 X:56828022-56828044 GGTCAGAAAATAACAGATGCTGG - Intergenic
1192229646 X:69256196-69256218 GCTCAGAACTTACCACCTGCTGG + Intergenic
1193200965 X:78690104-78690126 GGTCAAAAAATAACACATGCTGG - Intergenic
1194046959 X:89019680-89019702 AGTCAGGAAACAGCACCTGCTGG + Intergenic
1195270720 X:103227547-103227569 GGTCAGAAAAGCAGAACTGCTGG + Intergenic
1196999490 X:121422920-121422942 GGTCAGAGAAGACTTCCTGGAGG - Intergenic
1197098365 X:122622209-122622231 GGTTAAACAAAACCACCTGCTGG + Intergenic
1197840052 X:130736666-130736688 GGTCAGTAAATACCACCTATAGG - Intronic
1199820008 X:151435515-151435537 GGTCTGAAAATACCAGGTGCTGG - Intergenic
1201062713 Y:10062082-10062104 AGTCAGGAAAGAACACGTGCTGG + Intergenic