ID: 997880958

View in Genome Browser
Species Human (GRCh38)
Location 5:137589251-137589273
Sequence GAGTGTTTCCAGGAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997880952_997880958 10 Left 997880952 5:137589218-137589240 CCGGGGGAGCATGAAGGAGTGTT 0: 1
1: 0
2: 0
3: 14
4: 139
Right 997880958 5:137589251-137589273 GAGTGTTTCCAGGAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997880958 Original CRISPR GAGTGTTTCCAGGAAGAGGA AGG Intronic
No off target data available for this crispr